Gencode

The rules of variation: Amino acid exchange according to the rotating circular genetic code

Fernando Castro-Chavez

J Theor Biol. 2010 Apr 2. [Epub ahead of print]

http://tinyurl.com/y2koqpd

Figure taken from:

http://www.biology.lsu.edu/heydrjay/1201/Chapter17/SCI_Amino_Acid_CIRCLE.jpg

Abstract

General guidelines for the molecular basis of functional variation are presented while focused on the rotating circular genetic code and allowable exchanges that make it resistant to genetic diseases under normal conditions.

The rules of variation, bioinformatics aids for preventative medicine, are:

(1) same position in the four quadrants for hydrophobic codons,

(2) same or contiguous position in two quadrants for synonymous or related codons, and

(3) same quadrant for equivalent codons.

To preserve protein function, amino acid exchange according to

the first rule takes into account the positional homology of essential hydrophobic amino acids with every codon with a central uracil in the four quadrants,

the second rule includes codons for identical, acidic, or their amidic amino acids present in two quadrants, and

the third rule, the smaller, aromatic, stop codons, and basic amino acids, each in proximity within a 90 degree angle.

I also define codifying genes and palindromati, CTCGTGCCGAATTCGGCACGAG

...

Please cite this article as:

Castro-Chavez, F., The rules of variation: Amino acid exchange according to the rotating circular genetic code. J. Theor. Biol. (2010), 264(3):711-721., doi:10.1016/j.jtbi.2010.03.046

...

My earlier work on the palindromati contaminant can be found at:

http://www.iscid.org/pcid/2005/4/2/chavez_palindromati.php

I just submitted for consideration its 2010 update.

Here is the abstract, appeared on May, 2011, with the sequel of my studies on the genetic code!:

Castro-Chavez F. The Rules of Variation Expanded, Implications for the Research on Compatible Genomics. Biosemiotics. DOI: 10.1007/s12304-011-9118-0

http://www.springerlink.com/content/u474w265l55h0701

...

If you are interested in the practical development of these rules of variation that I found in the rotating circular genetic code and in my work to improve the stringency of the nucleotide database filters, please let me know. Do you live in Houston and are interested in sponsoring my work? (My personal email is within the title link, thanks!)