Research on Intelligent Design

To put together scientific advances from the perspective of Intelligent Design.

Wednesday, October 31, 2012

A Visual Mormon Reproof

This is a visual study in order for you to forensically track the fingerprints of Mormonism (references below each image; frequent references at the end of this study):

                                                             Fig. 1 - PGP p. 28 [885] of *




                                                          Fig. 4 - PGP p. 28 [885] of *



Fig. 6 - PGP p. 29-30 [886-887] of *

Fig. 7 - p. 2 of **



                                                 Fig. 9 - PGP p. 36 [893] of *



Fig. 11 - ***

Fig. 12 - ***

Fig. 13 - ***

Fig. 14 - PGP p. 37 [894] of *


Fig. 16 - p. 2 of ** also * PGP p. 38 [895, ‘Ab. 3:25b-4:4a’ {plagiarism and adulteration of KJV Gen. 1:1-4a}]

Fig. 17 - PGP p. 41 [898] of *

Fig. 18 - ****

Fig. 19 - **** 


Fig. 20 - ****


Fig. 22 - p. 3 of ** also * PGP p. 5 [862, ‘Mo. 2:1:10’ {plagiarism and adulteration of KJV Gen. 1:1-10}]

Fig. 23 - p. 4 of ** also * PGP p. 18 and p. 20 [875, ‘Mo. 6:40’; and 877, ‘Mo. 7:2’ {plagiarism of Enoch Pseudepigrapha}] Some links in this figure are: http://books.google.com/books?id=218JbeU2POgC&pg=PA294&lpg=PA294&dq=Mahway&

Fig. 24 - p. 4 of ** also * D&C 95:7, p. 185 [744], manuscript: http://www.webcitation.org/6BpccLUwv , http://josephsmithpapers.org/paperDetails/revelation-book-2?p=69 plagiarized and adulterated from 1 Sam. 1:3 and many other places in the Bible, Lord of Sabaot means: Lord of Hosts; see: http://books.google.com/books?id=Q64GAAAAQAAJ 

Fig. 25 - p. 5 of **, also http://books.google.com/books?id=LrgUAAAAYAAJ [pp. 682-683 (OT) {Notice the prominent KJV italics, that Joseph Smith ‘translation’ (JST = IV) is NOT a translation but a tampered by adulteration version of the Bible with the added imaginations and deceptions of Joseph Smith, Sidney Rigdon, Oliver Cowdery, Parley P. Pratt, etc.}]

Fig. 26 - p. 5 of #, taken from references within pp. 1-8 of #


Fig. 28 - p. 8 of %

Fig. 29 - p. 1 of # 


Fig. 30 - p. 304 of @ also at * BoM p. 46 [61, ‘1 Ne. 20:1’ {plagiarism and adulteration of KJV Isaiah 48:1}]

Fig. 31 - p. 6 of ** also at * BoM pp. 81-82 [96-97, ‘2 Ne. 12:4b-21a’ {plagiarism and adulteration of KJV Isaiah 2:4-19}]

Fig. 32 - pp. 33-34 of # also at * BoM p. 112 [127, ‘2 Ne. 30:6’]


Fig. 33 - pp. 302-303 of @, and Mormon 'Scholars' always lie: http://liveweb.archive.org/http://byustudies.byu.edu/book_of_mormon_charts/charts/169.pdf , compare it with the original BoM of 1830 (p. 590) and a version of 1837 (p. 621) respectively, currently at *, p. IX [9]

Fig. 34 - p. 7 of **, also at * PGP p. 43 [900 {acknowledged tampered adulteration by Joseph Smith of the KJV Mt. 23:39-24:1-5a}]


Fig. 35 - pp. 292-297 of @; track the rest of contradictions by yourself at: http://josephsmithpapers.org/paperDetails/account-of-john-april-1829%E2%80%93c-dc-7?p=1 ,
http://josephsmithpapers.org/paperDetails/book-of-commandments-1833?s=&sm=none&tm=expanded&dm=image-and-text&zm=zoom-right&p=22 , also at *, pp. 13-14 [572-573, D&C 7 {another blatant lie by Joseph Smith and Oliver Cowdery tampering by adulterating Jn. 21:22 and verses around it}]


Fig. 37 - p. 8 of **, also http://boks.google.com/books?id=LrgUAAAAYAAJ [p. 278 (NT), see note to Fig. 25, as that is not a Joseph Smith ‘translation’, but a tampering by adultery, in this case of Rev. 12 and 13]

Fig. 38 - First 'revelation' of Joseph Smith related to his polygamy: He indicates to the Mormon white leadership of 1831 to take wives from the Native Indians in order for their offspring to become 'white', pp. 32-33 of #, also at: http://web.archive.org/web/20110703165954/http:/utlm.org/onlineresources/indianpolygamyrevelation.htm

Fig. 39 - The later interpolation known as the Rocky Mountains 'prophecy', pp. 30-32 of #, also at: http://liveweb.archive.org/http://www.utlm.org/onlinebooks/changech13.htm [also saved at http://www.webcitation.org/6BpgZOgo1

http://web.archive.org/web/20110703153836/http:/utlm.org/newsletters/no106.htm, 
http://www.webcitation.org/6BhlyArpT


Fig. 41 - The "Table of Jupiter" Talisman that Joseph Smith always carried with him, even at the moment of his death, he did not have the 'magic' garments then but certainly he had his superstitious talisman with him while Hyrum, his brother, had one of the many family enchantment 'parchments' owned by their dad. See also: http://liveweb.archive.org/fdocc.ucoz.com/fdocc-mormon-warlocks.pdf

Fig. 42 - p. 1 of **, Parts of the 1844 political U.S. Presidential campaign poster of Joseph Smith (JS) and Sidney Rigdon, with subliminal hidden symbols and words; JS and Hyrum were Masons (see ‘endowment’), having unlawfully destroyed the Nauvoo Expositor that lawfully exposed their ‘plural marriages’ (JS at least had ~33 hidden ‘wives’) while lying in sermon and ‘doctrine’ as JS did since the beginning, lying at full hands, carrying always a hidden table of Jupiter’ talisman while Hyrum carried a ‘family parchment filled with occult symbols even at their death.




Final Notes:

Additional putative sources for Joseph Smith’s et al. inspiration’ are out of the scope of this brief study, as well as deeper studies tracking design and pattern-recognition, such as special software (Dale), plus linguistics, history, DNA and genetics, anthropology, archaeology, sociology, old newspapers, & decisions

Two sets of final references have been linked to the version 1.9 as I did learn more and more about the two tenets of Mormonism, with the heart to help them to dwell only on the Bible: 1) “Ye shall not surely die” (this is the first and successful deception of Satan as seen not only in Mormonism starting with Moroni or Nephi while expanding it to the extreme, but also seen in Catholicism, Spiritualism, and in mainstream Protestantism); 2) “Ye shall be as God” (a shame for ‘Christianity’ but even most shameful for Mormonism. According to JS et al., the lie [promoted by Mormonism] is: “ye shall be Gods,” having your own worlds populated by the offspring of your multiple ‘celestial wives’).

Frequent references:







Monday, April 05, 2010

Gencode

The rules of variation: Amino acid exchange according to the rotating circular genetic code
Fernando Castro-Chavez
J Theor Biol. 2010 Apr 2. [Epub ahead of print]


Figure taken from:

Abstract

General guidelines for the molecular basis of functional variation are presented while focused on the rotating circular genetic code and allowable exchanges that make it resistant to genetic diseases under normal conditions.

The rules of variation, bioinformatics aids for preventative medicine, are:

(1) same position in the four quadrants for hydrophobic codons,

(2) same or contiguous position in two quadrants for synonymous or related codons, and

(3) same quadrant for equivalent codons.

To preserve protein function, amino acid exchange according to

the first rule takes into account the positional homology of essential hydrophobic amino acids with every codon with a central uracil in the four quadrants,

the second rule includes codons for identical, acidic, or their amidic amino acids present in two quadrants, and

the third rule, the smaller, aromatic, stop codons, and basic amino acids, each in proximity within a 90 degree angle.

I also define codifying genes and palindromati, CTCGTGCCGAATTCGGCACGAG

...

Please cite this article as:

Castro-Chavez, F., The rules of variation: Amino acid exchange according to the rotating circular genetic code. J. Theor. Biol. (2010), 264(3):711-721., doi:10.1016/j.jtbi.2010.03.046

...

My earlier work on the palindromati contaminant can be found at:

http://www.iscid.org/pcid/2005/4/2/chavez_palindromati.php

I just submitted for consideration its 2010 update.

Here is the abstract, appeared on May, 2011, with the sequel of my studies on the genetic code!:

Castro-Chavez F. The Rules of Variation Expanded, Implications for the Research on Compatible Genomics. Biosemiotics. DOI: 10.1007/s12304-011-9118-0

http://www.springerlink.com/content/u474w265l55h0701

...

If you are interested in the practical development of these rules of variation that I found in the rotating circular genetic code and in my work to improve the stringency of the nucleotide database filters, please let me know. Do you live in Houston and are interested in sponsoring my work? (My personal email is within the title link, thanks!)

ShCherbak and the Code

To quote important observations by Vladimir ShCherbak:

shCherbak VI. Arithmetic inside the universal genetic code. Biosystems. 2003 Aug;70(3):187-209.

“…one may assume that natural computing can exist as well. For instance, such a computing could be essence of exact gene processing and scrambling (Landweber and Gilbert, 1993; Landweber et al., 2000). If that is the case, some cell organelles should work as biocomputers. Thereby, we have to discover the number systems with which they work.” “…the genetic code is connected more closely to abstract notions of arithmetic than with notions of physics or chemistry.”

The Arithmetical Origin of the Genetic Code

http://www.springerlink.com/content/t85w0h771510j187

http://tinyurl.com/y9w5gfj

“There seems to be but one conclusion: the genetic code is itself a unique structure of arithmetical syntax. The arithmetical syntax is separated from natural events by the unbridgeable gap between the fundamental laws of nature and the abstract codes of the human mind (Barbieri, 2005). Chemical evolution, no matter how long it took, could not possibly have stumbled on the arithmetical language and initialized the decimalization of the genetic code. Physics and chemistry can neither make such abstractions nor fit the genetic code out with them. It seems that the genetic code appeared as pure information like arithmetic did.”

There is no plausible chemical logic to couple directly the triplets and the amino acids. In other words, the principles of chemistry where not the sought essence of the genetic code

The zero is the supreme abstraction of arithmetic. Its use by any alphabet, including the genetic code, can be an indicator of artificiality.”

“The place-value decimal system represented through digital symmetry of the numbers divisible by prime number (PN) 037. This arithmetical syntactic feature is an innate attribute of the genetic code. The PN 037 notation with a leading zero emphasizes zero’s equal participation in the digital symmetry. Numbers written by identical digits are devised by PN 037 x 3 = 111 and 1 + 1 + 1 = 3 and appear regularly [from the figure: 037 x 6 = 222 and 2 + 2 + 2 = 6, 037 x 9 = 333 and 3 + 3 + 3 = 9, 037 x 12 = 444 and 4 + 4 + 4 = 12, 037 x 15 = 555 and 5 + 5 + 5 = 15, 037 x 18 = 666 and 6 + 6 + 6 = 18, 037 x 21 = 777 and 7 + 7 + 7 = 21, 037 x 24 = 888 and 8 + 8 + 8 = 24, 037 x 27 = 999 and 9 + 9 + 9 = 27].”

“The feature not only excites our sensation of beauty but may simplify some computational procedures too. Moreover, decimalization of the genetic code may be a special case of the general computational power of genomics and their molecular machinery. In fact, the only reason for a number system to appear is for arithmetic calculations.”

“In fact, there is no way to write or read any gene when no code is available. Thanks to its immutability, the universal genetic code is the most accurate information messenger from the time of genesis to the present.”

First, a general and the most forcible argument: it has been found that the genetic code is governed directly by the arithmetical symbol of zero. This striking fact is verified simultaneously by several independent orderlinesses – logical, arithmetical, and semantical… Incidentally, such an acting zero alone might be sufficient to assume an artificial nature of the genetic code.”

There is a complete set of information symbols utilizing the decimal syntax 111, 222, 333, 444, 555, 666, 777, 888, 999 in the genetic code. Each of these symbols consists uniformly of a carrier (balanced nucleons) and a meaning (the decimal syntax).”

“As a rule, possible consequences of the mutations such as an abrupt change of hydrophobicity are, to some extent, weakened (e.g. Sjostrom and Wold, 1985; Figureau, 1987; Knight et al., 1999).”

“… when amino acids are replaced through mutation the change of hydrophobicity is generally weak, while that of size is strong.”

If a point mutation occurs, the code amino acids are to a certain extent protected against an abrupt change of their hydrophobicity but not of their geometric size.”

Arithmetic is the only tool for producing information systems of extremely high efficiency. Life, being an information phenomenon, could use arithmetic for control, integrity, and precise alterations of its genetic texts.”

“One can speculate that some regular arithmetical background may “underlie” genetic sequences without limitation to their biological context. Analyzing its own arithmetic, such background might check, restore, and alter superimposed biological context by means of calculations omitting translation.”

“Almost half a century ago, the idea of chemical evolution determined a stochastic (random) approach to the origin of the newly deciphered genetic code. The molecular machinery of genetic coding revealed however a baffling complexity. It is common practice to criticize the stochastic approach because the likelihood that this machinery could have been produced by chance is extremely low if not negligible. But, on the other hand, the basic premise of the stochastic approach is that billion years and countless natural events could realize, nevertheless, practically impossible things. This vicious circle exists because both these opposing opinions appeal to the same concept – to the assessment of chances of natural events. One needs therefore properties of the genetic code that eliminate any possibility of a dual interpretation or overlapping of the arguments. In these terms, only the facts whose essence cannot be reduced to natural events can solve the original problem. We believe that a part of these facts have been presented and discussed above.”

I just found another compilation on shCherbak's work, by Craig Paardekooper:
http://www.craigdemo.co.uk/circleoflife.pdf
Where it was concluded:

"The existence of such perfect mathematical balance within the genetic code may be taken as evidence of Intelligent Design. As ShCherbak states, the only conceivable way for the summation to have appeared would be by some arithmetical process. Did arithmetic precede life?"

Monday, November 30, 2009

The Fruitfulness of ID Research

Today (Monday, November 30, 2009), on his 'Recursivity' blog, Shallit states that one paper includes: "a case of inappropriate citation".

His full paragraph:

"10. Fernando Castro-Chávez, "Hepatology Microarrays, antiobesity and the liver", Annals of Hepatology 3 (4) (Oct-Dec 2004), 137-145. Full paper here. A case of inappropriate citation. The only citation to Meyer comes in the final paragraph, which reads "... to better describe the identity and function of genes and genomes, composers of a natural, complex, and precise biological software that as a genetic program, contributes to the healthy programming and the pathological reprogramming of life." The author appears to be an intelligent design advocate. I predict that inappropriate citation -- the bogus insertion of citations to pro-ID papers in irrelevant contexts -- will become more popular in the future, as creationists attempt to bolster their case that ID is scientific."


Here, I want to emphasize that at the end of the Hepatology paper we read: "...a natural, complex, and precise biological software that as a genetic program, contributes to the healthy programming..." (reference 114 *).

Such statement complements the writing at the beginning of the paper, where we read: "The mRNA abundance and its mechanisms of assembly are two complementary areas. Using Intelligent Design models, we can use the analogy of the nucleic acids (DNA and RNA) as being the Software for the building up of proteins, and the proteins as being the Hardware, with the special feature that here, the Software builds up the Hardware and the Hardware plays and modulates the Software. In the case of metabolic pathways, the proteins are sufficiently flexible to become part of the regulatory Software, in a stairway of self-contained types of Hardware: organelles, cells, tissues, organs, organisms, etc."

* Reference 114 is:

Meyer SC. The origin of biological information and the higher taxonomic categories. Proc Biol Soc Washington, 2004; 117(2): 213-239.

Here is a sampler of ten excerpts of Meyer's paper pertinent to the Hepatology paper's context on biological programming:

1 -
"...arises only if the programmer of the model system “tunes” it in..."


2 -
"...this necessary tuning involves an intelligent programmer selecting certain parameters and excluding others--that is, inputting information."


3 -
"A system of interconnected lights governed by pre-programmed rules may well settle into a small number of patterns within a much larger space of possibilities."


4 -
"...agents previously programming the system..."


5 -
"A computer user who traces the information on a screen back to its source invariably comes to a mind--that of a software engineer or programmer."


6 -
"Genetic algorithms are programs..."


7 -
"Dawkins and Kuppers, for example, have developed computer programs..."


8 -
"...these programs only succeed by the illicit expedient of providing the computer with a “target sequence” and then treating relatively greater proximity to future function (i.e., the target sequence), not actual present function, as a selection criterion."


9 -
"...Gilbert et al. (1996) argued that changes in morphogenetic fields might produce large-scale changes in the developmental programs and, ultimately, body plans of organisms. Yet they offered no evidence that such fields--if indeed they exist--can be altered to produce advantageous variations in body plan, though this is a necessary condition of any successful causal theory of macroevolution."


10 -
"Thus, it might be argued that such differences show that early developmental programs can in fact be mutated to produce new forms. Nevertheless, there are two problems with this claim. First, there is no direct evidence that existing differences in sea urchin development arose by mutation. Second, the observed differences in the developmental programs of different species of sea urchins do not result in new body plans, but instead in highly conserved structures."

At the start and at the end of the "Microarrays, Antiobesity and the Liver" paper we read about information in health and disease. Meyer’s paper is focused on molecular information; so, the citation of Meyer's paper as reference number 114 is appropriate.

For Intelligent Design to be more fruitful as a research paradigm, grants need to be awarded to it, even in disregard of ID being the target of a Darwinian "witch hunt", as the equivocal statement of Shallit clearly demonstrates.

Update on Wednesday, December 30, 2009:

Another 'bold' Darwinian, like the one that posted a first comment in this post, wrote on Shallit's post:

"Anonymous said... In case we haven't figured it out, Fernando Castro-Chávez is a creationist. I'm sure he'd say an IDist, but I've seen his website. Also, wasting time on Joe G is just that, wasting time. Best to just ignore him."

However, Joe G really brought "life" to that shallow post, writing amongst many, many other things:

"Joe G said...

Jeffrey,
Do you realize that all you have to do to refute ID is to actually start substantiating the claims of your position?
If you want to talk about fruitlessness you need to look no further than your position.
There isn't any peer-reviewed articles that demonstrate that accumulating genetic accidents can do what they are claimed to have done.
And when you say that ID is a " religio-political charade" you really expose your ignorance.
What religion?
Does ID say who to worship? No.
Does ID say anything about worship? No.
Does ID depend on religious texts? No.
Does ID require a belief in "God"? No.
Does Jeffrey Shallit think his ID ignorance is meaningful discourse? Yes."
Also:
"You don't have an argument only bald assertions.
Artificial life does not correlate to biology.
And Barbara Forrest is a known liar on an agenda.
1- Artificial life was made by man.
2- Anyone who says that ID is religious or ID is Creation is either a liar or on some agenda.
Want to know why?
Because they cannot support their claims. All Forrest can do is make bald assertions.
It appears that is all you have also.
ID does NOT say anything about worship- nothing about who, why, when, where nor how.
ID does not require a belief in "God".
ID does not require the supernatural."
"Takis,
ID is a branch of creationism only to the willfully ignorant.
All IDists are not religious.
I am an IDists and don't care about religion.
I said:
However there isn't any evidence that any amount of mutational accumulation can give rise to useful novel protein machinery and new body plans.
Jeffrey responds with:"A lie. Go read about the Italian mutation."
No new protein MACHINERY there Jeff. And definitely no new body plans.
Changing one protein does not create new protein machinery.
Heck we can't even test the premise that humans and chimps shared a common ancestor- no one knows if the transformations required are even possible.
Jeffrey:"You really have no idea how science works, do you?"
Unfortunately for you I do.
Ya see in science one needs to be able to test one's claims.
And to this day no one on this planet even knows whether or not the transformations required are even possible.
Joe says:
ID does not say anything about worship- nothiung about who, what, where, when nor how.
ID does not say anything about giving service.
ID is not based on any religious doctrine.
ID does not say anything about the supernatural.
ID does not require a belief in "God".
So Jeffrey responds with: "because any being with the causal powers to tweak the fundamental constants of nature - as ID followers claim - must be a god or have god-like powers."
Or just have advanced technology.
So the bottom line is ID is religious if and only if we change the definition of religion.
Got it.
Artificial life was made by man.
Jeffrey (wrote):"World's dumbest argument, Joe."
Why? It is true.
Man made artificial life and man doesn't know enough about biology in order to mirror it.
Jeffrey (wrote): "Every experiment we do was done by people, but that doesn't mean that every natural event studied is the result of intelligent intervention."
No but if man makes something then blind and undirected processes did not.
Jeffrey,
The designer could be "God" and that would not mean ID is religious.
IOW Jeffrey you don't seem to understand the definition of religion.

Some of the links added by Joe G:
http://intelligentreasoning.blogspot.com/2009/06/biological-evolution-what-is-being.html
http://www.newworldencyclopedia.org/entry/Intelligent_design
http://www.trueorigin.org/bacteria01.asp
http://www.chem.duke.edu/~jds/cruise_chem/Exobiology/miller.html
http://www.creationresearch.org/crsq/articles/43/43_3/baraminology.htm
http://www.answersingenesis.org/get-answers/topic/speciation
http://www.discovery.org/a/2735
http://www.discovery.org/scripts/viewDB/filesDB-download.php?id=349
http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=697

Joe G also wrote:

' Other people have also weighed in on this- including John Morris, the president of the Institute for Creation Research:"...While all creationists necessarily believe in intelligent design, not all ID proponents believe in God. ID is strictly a non-Christian movement, and while ICR values and supports their work, we cannot join them." '

And from Andrew Rowell's Blog: http://idintheuk.blogspot.com/2009/12/proof-of-truth-is-in-citation-index.html

Friday, August 01, 2008

A GREAT CRYPTANALYST HAS DIED

William (Bill) Reed
(1929-2008)

http://www.beatricedailysun.com/articles/2008/08/16/obituaries/doc48a5949f0954b041865802.txt

We are saddened to inform you that on July 30th William (Bill) Reed had died at his 79 years old.

"I finally found the Soviet submarines. It happened by accident. I had been hearing a “scratchy” sound for some time on various monitored circuits, but had passed it over as some kind of an anomaly, a spurious emission ... whatever. It was sort of like a burst of static ... but not quite. Then, one day, I made a sonograph-enlarged picture of a standard Soviet signal which happened to have one of these scratchy sounds almost on top of it. I spread it out and took a closer look. I’ll be damned! It had bauds! Tiny bauds, the most compressed signal that I had ever encountered ... but bauds. It was a man-made signal, and it obviously was not one of ours. Gotcha! It was a burst signal, and it had to be a Russian sub. We fired the recording directly to the National Security Agency, and they were ecstatic!"
Bill Reed.
IN MEMORIAM:

“Bill Reed’s Rocks and Shoals …chronicles his beginnings as a dirt-poor kid saddled with an abusive step-father, yet a boy who later rose to such a prominent position with U.S. Naval Intelligence that he was given the enormously important job of briefing President John F. Kennedy during the Cuban Missile Crisis—a predicament a thousand times more dangerous than the more recently trumped-up “imminent danger” posed by Iraq.

However, thanks to a secret new defense system which could track Soviet submarines in the Caribbean (CODEWORD: BORESIGHT)—and whose efficacy Reed was able to “sell” to JFK—America managed to avoid a potential nuclear conflict without having to shed the blood of a single human being. (Anyone listening in Washington?)

Throughout a life that unreels like a fascinating novel, Reed emerges as a quintessential American, yet one sublimely aware that duty to country should always come second to loyalty to conscience.”

Alejandro Grattan, Chief Editor El Ojo del Lago, Chapala, Jalisco, Mexico.
[Broken link: http://www.garcesbooks.com]

HOW THE SHADOW GOVERNMENT’S U.S. “INTELLIGENCE” PAYS BACK TO THE U.S.A. PATRIOTS

Chapter Eleven

Crucifixion and Resurrection
p. 221-234
“…She (Joyce, then Bill’s wife) went to her bedroom. I made a pallet on the floor. I was emotionally, mentally and physically exhausted, but I couldn’t sleep. I could never seem to be able to sleep lately. Perhaps sleeping pills would help? I found some in the bathroom and took a few. Nothing. Ten minutes later I took some more, and finally become drowsy. It occurred to me that perhaps I had taken too many. Who cares? The world would probably be better off without me. I fell asleep.”

And the telephone rang. It had probably been ringing for some time. I came out of it slowly. I looked at my watch. I had been asleep only some ten minutes. I felt awful. I remember thinking, Alcohol and Guilting is a Killer! Then, Don’t Guilt while Drinking! Somehow that struck me as funny. It was the first thing that I had thought funny for a long time. I answered the phone. It was Pat Webb.

Pat said, “Hey, Man! We’ve been calling all over town trying to find you. Come on over. We need you!”
“What do you mean, you need me?”
“We’re in trouble. No money. No job. Can’t pay the rent. Lot’s of problems. I need a friend, Man. Come on over. We’ve got to talk.”
I said, “Okay, Pat. I’ll be there in half an hour. I’ll bring a bottle.”
Pat said, “Well, that sounds good, but as long as you’re going to the store, could you also bring some food? We haven’t eaten in a week!”
“Sure”

“…I was walking down a corridor in the NSA (National Security Agency) building thinking… everything is going to be just… and I collapsed.”

“… They took me to the NSA dispensary. The doctor examined me, and then asked, “Have you taken any medicines lately? Any pills?”
Without thinking of the consequences, I replied,
“Yes, sleeping pills.”
“How many?”
“To tell you the truth, I don’t remember”
That did it. From that moment on, my fate was sealed… Attached to the doctor’s admission request was a flag “possible suicide attempt.”
“…Whether it was proven suicide attempt or not. I knew that my career in Intelligence work was over. The NSA never took chances. I would never again be trusted with a Top Secret CODEWORD security clearance. And without that, I was out of the spook business.”

“…but the question of my loyalty had to be raised: What had prompted a Golden Boy candidate like Reed, a man practically assured of achieving senior rank, to want to take his life? Guilt? Guilt over what?”
“…Could he be a double agent? Was he possibly a plant? He had volunteered for this work, remember? He hadn’t been selected at random from prior-screened candidates as was the normal route to intelligence work. Damn! We could have been set up; and this sonofabitch knows where the family jewels are stashed!”
“A full-scale investigation into my background was ordered. No stone was to be left unturned… I had completely blanked from my memory the name of the bastard who was assigned over-all responsibility for my investigation, but we have to call him something. “Jones” will do…”
“… The first thing I discovered when I returned to the B.O.Q. (Bachelor Officers Quarters) was the fact that they had entered my quarters and ransacked the place for evidence against me.”

“…Then they proceeded to interrogate everyone I had ever known or communicated with… kindergarten teacher on up. They missed surprisingly few. I began to receive calls from friends all over the world:
What’s your problem?
Are you in bad trouble?
The guy said I wasn’t to tell anyone that he had talked with me. He said the security of the nation was involved. Damn, Reed! What have you done?”
I guess they really worked over poor Olga in Norway; and every other female liaison whose address I had been foolish enough to record. They had photographed everything…”

“… I was being followed, or stalked out, 24-hours a day, day in and day out. I noticed two men parked outside the B.O.Q. entranceway every night, motor running to keep the heater going. I knew they were there to keep tabs on me. Who else? Then I began to observe tail cars on my trips between Fort Meade and Bethesda. I was still on outpatient status and required to check in several times a week to ensure that I wasn’t a backslider.
I started to tabulate the number of cars assigned to me: one, two, three, and four…
At first the changeovers were professional, made at random. But then, as I knew they would, they became conditioned, casual. After almost a month of this, they became sloppy and fell into a routine that made their job easier…”

“I was so cooperative that I went outside and talked with the agents in the night car assigned to me. They wanted no part of that at first, but I finally convinced them that my intentions were pacific… Slowly, over a period of time, I began to gain their confidence, and some sympathy for my situation. Like my day keepers, they began to relax, and view me as an easy target… They had my wife’s apartment stalked out also. She had undergone intensive interrogation, and so had my children. Agents had even followed Pamela and Billy to school, and talked with their teachers. This was too much. I wasn’t angry; I was furious. I wouldn’t be pushed any further.”

“I had given some eighteen years of my life to my country, serving in the best and most conscientious manner of which I was capable… As a reward an agency of my government was treating me as a man already found guilty of some heinous crime, and that implied guilt was rubbing off on my friends and family…”

“…I had noticed that there were a few moments after I made that sharp curve, where I usually lost sight of my tail. My speed had always remained constant, but one morning as I made the curve I speeded up, then turned abruptly in at the back entrance. As I suspected, a puzzled caravan of searchers sailed on by towards the Main Gate… I drove to an alternate out-of-the-way parking lot, took out a pre-packed bag containing extra uniforms, civilian clothing, and everything else that I would need for a week vacation… I walked a roundabout path to the main gate. I was by this time in dress-white uniform. The Marine guard saluted me smartly. I stepped to the bus stop and caught the first bus going anywhere. I just wanted to get out of sight…”

“…the harassment continued: surveillance, parked cars overnight, the tailing. Now they were even following Joyce and the children to the grocery store!”
“… I was sent to be questioned by the first team: CIA H.Q., Langley. I took the polygraph, and was transferred shortly thereafter to an unclassified desk at the Pentagon…”
“One day as I parked in the Pentagon lot, I saw a young agent get out of a tail car and follow me into the building. I waited on a stairway. As he came hurrying along I stepped out from a corner and stopped him with a hand on his chest. I said, “Okay, kid. You want to follow me? Here, take my hand and I’ll lead you to my desk.” The kid came unglued. He stuttered.
“What… who are you? Are you some kind of queer… or somethin’?...” Then he turned and ran back down the stairway. The next day I was re-admitted to Bethesda Hospital…”
“It was obvious that I had been re-admitted to Bethesda just to get me off the street. I was an embarrassment to them. Why couldn’t I slink around looking guilty and frightened like any normal suspect? …”

“…I awaited the verdict from what looked like a hung jury. Somebody (probably Mr. Jones) didn’t want to give up. I had to be guilty of something! CIA once more for polygraphs, more waiting…”
“…On the way out I was stopped by Mr. Jones. He said,
“Lieutenant, you are either the cleanest sonofabitch I’ve ever encountered or the smartest criminal. Whatever the case, I don’t want you to relax too much; I’ll be looking over your shoulder from time to time.”
I replied, “I suppose I can’t prevent that, Mr. Jones, but I will make you a promise. If you ever molest my family again, especially my children, I’m going to look you up, personally. I’ll even do better than that. I’ll take this public. Regardless of what happens to me, I will reveal things that you and your agency have done that I suspect won’t help your career at all. A competent investigator would have cleared me in two weeks, without recourse to harassment. I will embarrass you, and a great many people. Think about that. Don’t relax too much.”

p. 250-251
The Ubiquitous “Jones Boys”
“Yeah, the bastards were still at it. I was sitting in my office at the 32nd St. Naval Station one morning, when I was advised that I had two visitors from that organization (the ONI, “Office of Naval Intelligence”) who wished to speak with me in private. I recognized them as soon as they stepped through the door. Jones’ Boys – or imitations thereof from some other Spook organization. The interview, or rather interrogation, followed the usual lines…
After that interview I had little illusions as to continuing my career in the Real Navy. Nor did I wish to do so. I put in my papers.”

p. 258
“…The Jones Boys were still on my tail. Unnoticed visits to my modest beach house in Rosarito:
Have you had any relationships with “suspect” characters in your “defection” to South of the Border?
Why did you move to Mexico so suddenly?
Have you been contacted by anyone asking questions regarding your work at NSA?
I’m afraid that I wasn’t all that cooperative. I offered them frijoles, tortillas and tequila, but to every other question I simply grinned broadly and asked, “What do you think?”
This really was the last straw. I decided to move further south… bought a beefed-up Buick to pull my house trailer and headed for the “badlands” of Mexico. If the ONI spooks wanted to follow me, fine, but I sure as hell wasn’t going to make it easy on them.”
“I simply could not believe that these idiots still suspected that I was a Soviet agent, or at least a turncoat. If I had been so, I would not be living in an old beat-up trailer in Mexico and drinking cheap tequila… Couldn’t these dumb bastards figure that one out?”

“I was furious! I decided to get as far away as possible. I needed a vacation. I took it, in Puerto Vallarta, Mexico, and it has lasted some thirty-three years.”
“In closing I only want to say that the United States Navy has been good to me. Forget the NSA, CIA and the ONI; they don’t know the difference between a rope, a line, a hawser or a shoestring. And if they ever knew the words Integrity, Service and Honor, they have surely forgotten them completely.”
--------------------------------
Bruce Ivins, another current victim of the "intelligence's stupidity"? (Manipulated by the "Shadow Government", the same one that "planted" faked evidence on 9/11, being the worst fake the TV Fakery of fake "planes" hitting WTC1 and WTC2)
"Ivins' lawyer says his client was totally innocent and that he killed himself because of the FBI's harassment. He was receiving psychotherapy in the weeks before his death and was banned from the premises of his research lab. Yesterday, a spokesperson for Ivins' lab, the U.S. Army Medical Research Institute of Infectious Diseases at Fort Detrick said the agency "mourns the loss of Dr. Bruce Ivins, who served the institute for more than 35 years as a civilian microbiologist." That seems like an unusual thing to say if you believe one of your employees had something to do with an anthrax attack."
Links:
Also:
On Tuesday, August 05, 2008 the Associated Press wrote:
“In the current case, Ivins complained privately that FBI agents had offered his son, Andy, $2.5 million, plus "the sports car of his choice" late last year if he would turn over evidence implicating his father in the anthrax attacks, according to a former U.S. scientist who described himself as a friend of Ivins.”
The initial wording also includes the next:
“Army scientist Bruce Ivins told friends that government agents had stalked him and his family for months, offered his son $2.5 million to rat him out and tried to turn his hospitalized daughter against him with photographs of dead anthrax victims.
The pressure on Ivins was extreme, a high-risk strategy that has failed the FBI before.”
Then it continues:
“Ivins also said the FBI confronted Ivins' daughter, Amanda, with photographs of victims of the anthrax attacks and told her, "This is what your father did," according to the scientist, who spoke only on condition of anonymity because their conversation was confidential.
The scientist said Ivins was angered by the FBI's alleged actions, which he said included following Ivins' family on shopping trips.”
“The FBI declined to describe its investigative techniques of Ivins.
FBI official John Miller said that "what we have seen over the past few days has been a mix of improper disclosures of partial information mixed with inaccurate information and then drawn into unfounded conclusions. None of that serves the victims, their families or the public."”
“It is unclear how the FBI eliminated as suspects others in the lab who had access to the anthrax. It's not clear what, if any, evidence bolsters the theory that the attacks may have been a twisted effort to test a cure for the toxin. Investigators also can't place Ivins in Princeton, N.J., when the letters were mailed from a mailbox there.”
“Richard Schuler, attorney for anthrax victim Robert Stevens' widow, Maureen Stevens, said his client will attend Wednesday's FBI briefing with a list of questions.
"No. 1 is, 'Did Bruce Ivins mail the anthrax that killed Robert Stevens?"' Schuler said, adding, "I've got healthy skepticism."”
Another magazine (The New York Times) wrote:
"Dr. Ivins, a 62-year-old father of two, took an overdose of Tylenol with codeine."
“A lawyer who had represented Dr. Ivins since May 2007, Paul F. Kemp, insisted that Dr. Ivins was innocent and had been driven to suicide by false suspicions… Mr. Kemp said in a written statement, calling the microbiologist “a world-renowned and highly decorated scientist who served his country for over 33 years with the Department of the Army.”
“We assert his innocence in these killings and would have established that at trial,” Mr. Kemp said. “The relentless pressure of accusation and innuendo takes its toll in different ways on different people, as has already been seen in this investigation.””
“Scientists familiar with germ warfare said there was no evidence that Dr. Ivins, though a vaccine expert with easy access to the most dangerous forms of anthrax, had the skills to turn the pathogen into an inhalable powder.
“I don’t think a vaccine specialist could do it,” said Dr. Alan P. Zelicoff, a physician who aided the F.B.I. investigation when he worked at the Sandia National Laboratories in Albuquerque.
“This is aerosol physics, not biology,” Dr. Zelicoff added. “There are very few people who have their feet in both camps.””
“Representative Rush Holt, a Democrat whose district includes the Princeton, N.J., mailbox where investigators believe the letters were mailed, said the F.B.I. should provide a full briefing.
“What we learn,” Mr. Holt said, “will not change the fact that this has been a poorly handled investigation that has lasted six years and already has resulted in a trail of embarrassment and personal tragedy.””
Another Anthrax links: