Palindromati
Palindromati
fdocc at yahoo dot com
Independent Biotechnology.
ABSTRACT
Based on my previous experimental work I demonstrate the lack of expression for the palindromic linker, which means that it is not present in the original tissue but appears after the cloning process, being then an artificial product of the host-vector interaction. The same finding can be demonstrated, as I have done in my original article, by using any of the public results for Affymetrix microarrays based on sequences reported to Genbank.
The Next Figure (which appears bigger in the original article):
Demonstrates that the phenomenon of self-hybridization of the palindromic EcoRI-like linker seems to be blocking the enzymatic digestion.
This article has been uploaded to the Archive of the ISCID, which is the International Society for Complexity, Information and Design:
http://www.iscid.org/boards/ubb-get_topic-f-6-t-000582.html
I have presented additional evidence in an expanded Table as well as in Zipped files with thousands of examples taken from both the Genbank and the Affymetrix DNA-Chips:
http://www.reocities.com/plin9k/t2.htm
fdocc at yahoo dot com
Independent Biotechnology.
ABSTRACT
This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5’UTR or 3’UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.With the Next Figure:
The Next Figure (which appears bigger in the original article):
This article has been uploaded to the Archive of the ISCID, which is the International Society for Complexity, Information and Design:
http://www.iscid.org/boards/ubb-get_topic-f-6-t-000582.html
I have presented additional evidence in an expanded Table as well as in Zipped files with thousands of examples taken from both the Genbank and the Affymetrix DNA-Chips:
http://www.reocities.com/plin9k/t2.htm
3 Comments:
Dear Fernandez,
I just received a very interesting article that could be of interest:
Durston KK, Chiu DKY
A functional entropy model for biological sequences
DYNAMICS OF CONTINUOUS DISCRETE AND IMPULSIVE SYSTEMS-SERIES B-APPLICATIONS & ALGORITHMS 2: 722-725 Sp. Iss. SI 2005
This paper introduces functional entropy as a measure of entropy that incorporates functional interpretations corresponding to certain biological functions. A measure of change of functional entropy is defined to measure entropy change between two functional states. We show here two biosequence analysis experiments based on the ankyrin repeat and the Ubx box gene. They show how two related biomolecules with different biological functions can be compared and analyzed. Furthermore, with a given limit on entropy change, intermediaries between states can also be estimated and evaluated.
Durston says of this paper: "Finding novel proteins is unlikely to occur through a series of functional intermediates, and will therefore degenerate to a random walk.
Dear Albert,
Thank you very much for the information.
Fernando.
Fernandez,
I noticed that the lac repressor binds to a palindromic sequence. The DNA binding is performed by two identical dimers that is bound together strongly by multiple interaction.
There are four principle clusters of amino acids in the tetramer that comprise the interface between the two monomers of each dimer <> : residues 70-100, 221- 226, 250-260, and 275-285 <>. Point mutations in any of these clusters, excluding 250-260, will result in only the monomeric form of the repressor. The binding between the two dimers is extremely strong due to the number of interactions.
One could ask the question; what came first, the palindrome or the protein-protein interactions. Both seems to be required to form a complete tetrameric lac-repressor
If we use our main stream science hats, are palindromes thought to be some kind of mutations?
Albert
Post a Comment
<< Home