Palindromati

Palindromati

fdocc at yahoo dot com
Independent Biotechnology.

ABSTRACT

This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5’UTR or 3’UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.

With the Next Figure:
Based on my previous experimental work I demonstrate the lack of expression for the palindromic linker, which means that it is not present in the original tissue but appears after the cloning process, being then an artificial product of the host-vector interaction. The same finding can be demonstrated, as I have done in my original article, by using any of the public results for Affymetrix microarrays based on sequences reported to Genbank.

The Next Figure (which appears bigger in the original article):

Demonstrates that the phenomenon of self-hybridization of the palindromic EcoRI-like linker seems to be blocking the enzymatic digestion.

This article has been uploaded to the Archive of the ISCID, which is the International Society for Complexity, Information and Design:

http://www.iscid.org/boards/ubb-get_topic-f-6-t-000582.html

I have presented additional evidence in an expanded Table as well as in Zipped files with thousands of examples taken from both the Genbank and the Affymetrix DNA-Chips:

http://www.reocities.com/plin9k/t2.htm