"Anonymous" criticizes such Palindromatic discovery
Anonymous wrote:
My response: I presented my work originally as a review on the subject because it reviews the thousands of sequences in the Genbank containing palindromes.
My response: My research field on published sequences quality control is a brand new one and I am proud to provide it... I have seven related publications, as presented in my list..., two of them corresponding to specialized book reviews.
My response: Yes, because it was a critical review of the palindromes that are present in the Genbank. It is not prohibitive to present original data in a review...
My response: Correct!
My response: Real and in need to be corrected, to prevent additional biological and medical errors.
My response: My note on Table 2 declares that "Note: This table presents the EcoRI related linker ctcgtgccgaattcggcacgag as it appears in Genbank for some human genes. To view the rest of this Table 2 and the presence of the linker in other organisms, refer to URL: http://www.geocities.com/plin9k/t2.htm"
The additional data of the full Table 2 is to add or build up the case.
I wanted to wait until the article was published to release these 150 examples, plus other 850 examples to be linked at the feet of such full Table 2. This will give ...more than 1200 examples at:
http://www.geocities.com/plin9k/1200.zip (Zip Excell)
Also, ...the attachment for the palindromes present especifically in at least 70 Affymetrix samples:
http://www.geocities.com/plin9k/affy70.zip
As I mentioned before, that data is additional data, not key data...
My response: To find the thousands I mention, the original version of my article states that we need to modify the default conditions with the next values (Query conditions: 1000 as the number of descriptions and of alignments and 10^6 as the minimum expected number)...
go to the end of the Blastn page and set the conditions described in my article. If no conditions are set, the results obtained are the ones that _____________ presents... however, as I declare here, the conditions originally used are the ones that need to be set. The conditions used allow us a more expanded (thought not complete) retrieval of palindrome artifacts at http://www.ncbi.nlm.nih.gov/BLAST
For example, I just did a search again few days ago and ...thousands of results are thus obtained [as presented in my article]
My response: Yes, I suggest that when using the conditions described in my paper the number of cases increases, not being "few" cases, as described by ________________.
My response: Indeed, any researcher using standard sequencing procedures can get and report a palindromic artifact, as demonstrated in my article. As the Excell file depicts, Humans and Mice are the ones with the most abundant artificial palindromic matches, and that's precisely the reason why it is important to alert researchers working with other organisms, of the existance of such artifacts. The importance of the publication of this article is to alert every other researcher using similar methodologies.
1- The review or a focused mini review should be synthetic and critical and not just a review of the literature.
My response: I presented my work originally as a review on the subject because it reviews the thousands of sequences in the Genbank containing palindromes.
2- The author seems to have only three papers in PubMed. I don’t think he has the stature to write a review on this subject.
My response: My research field on published sequences quality control is a brand new one and I am proud to provide it... I have seven related publications, as presented in my list..., two of them corresponding to specialized book reviews.
3- This is supposed to be a review but original data is presented.
My response: Yes, because it was a critical review of the palindromes that are present in the Genbank. It is not prohibitive to present original data in a review...
4- The manuscript shows that an EcoRI linker sequence is present in several sequences reported to GenBank, either at their extremities or internally, which characterizes a chimera.
My response: Correct!
5- Although this observation is real…
My response: Real and in need to be corrected, to prevent additional biological and medical errors.
6- ...some key data is missing. Table II, which is supposed to contain all the GenBank sequences, is not available in the URL given by the author.
My response: My note on Table 2 declares that "Note: This table presents the EcoRI related linker ctcgtgccgaattcggcacgag as it appears in Genbank for some human genes. To view the rest of this Table 2 and the presence of the linker in other organisms, refer to URL: http://www.geocities.com/plin9k/t2.htm"
The additional data of the full Table 2 is to add or build up the case.
I wanted to wait until the article was published to release these 150 examples, plus other 850 examples to be linked at the feet of such full Table 2. This will give ...more than 1200 examples at:
http://www.geocities.com/plin9k/1200.zip (Zip Excell)
Also, ...the attachment for the palindromes present especifically in at least 70 Affymetrix samples:
http://www.geocities.com/plin9k/affy70.zip
As I mentioned before, that data is additional data, not key data...
7- The author mentions thousands of sequences in GenBank containing the artifactual sequence. I only found 210 when I blast the sequence given by the author against nr database.
My response: To find the thousands I mention, the original version of my article states that we need to modify the default conditions with the next values (Query conditions: 1000 as the number of descriptions and of alignments and 10^6 as the minimum expected number)...
go to the end of the Blastn page and set the conditions described in my article. If no conditions are set, the results obtained are the ones that _____________ presents... however, as I declare here, the conditions originally used are the ones that need to be set. The conditions used allow us a more expanded (thought not complete) retrieval of palindrome artifacts at http://www.ncbi.nlm.nih.gov/BLAST
For example, I just did a search again few days ago and ...thousands of results are thus obtained [as presented in my article]
8- The great majority of the cases are at the extremities of the sequence, while few are located internally. In the few cases that I looked more carefully, these seem to represent chimeras, as suggested by the author.
My response: Yes, I suggest that when using the conditions described in my paper the number of cases increases, not being "few" cases, as described by ________________.
9- It is interesting that about half of all cases come from few large-scale sequencing projects (Schistosoma japonicum and Tritium aestivum are the most prevalent). I suggest the author to contact the people responsible for these projects and communicate his findings.
My response: Indeed, any researcher using standard sequencing procedures can get and report a palindromic artifact, as demonstrated in my article. As the Excell file depicts, Humans and Mice are the ones with the most abundant artificial palindromic matches, and that's precisely the reason why it is important to alert researchers working with other organisms, of the existance of such artifacts. The importance of the publication of this article is to alert every other researcher using similar methodologies.

0 Comments:
Post a Comment
<< Home