Research on Intelligent Design

Gencode

2010-04-05T11:36:00.001-07:00

The rules of variation: Amino acid exchange according to the rotating circular genetic code

Fernando Castro-Chavez

J Theor Biol. 2010 Apr 2. [Epub ahead of print]

Figure taken from:

http://www.biology.lsu.edu/heydrjay/1201/Chapter17/SCI_Amino_Acid_CIRCLE.jpg

Abstract

General guidelines for the molecular basis of functional variation are presented while focused on the rotating circular genetic code and allowable exchanges that make it resistant to genetic diseases under normal conditions.

The rules of variation, bioinformatics aids for preventative medicine, are:

(1) same position in the four quadrants for hydrophobic codons,

(2) same or contiguous position in two quadrants for synonymous or related codons, and

(3) same quadrant for equivalent codons.

To preserve protein function, amino acid exchange according to

the first rule takes into account the positional homology of essential hydrophobic amino acids with every codon with a central uracil in the four quadrants,

the second rule includes codons for identical, acidic, or their amidic amino acids present in two quadrants, and

the third rule, the smaller, aromatic, stop codons, and basic amino acids, each in proximity within a 90 degree angle.

I also define codifying genes and palindromati, CTCGTGCCGAATTCGGCACGAG

...

Please cite this article as:

Castro-Chavez, F., The rules of variation: Amino acid exchange according to the rotating circular genetic code. J. Theor. Biol. (2010), 264(3):711-721., doi:10.1016/j.jtbi.2010.03.046

...

My earlier work on the palindromati contaminant can be found at:

http://www.iscid.org/pcid/2005/4/2/chavez_palindromati.php

I just submitted for consideration its 2010 update.

Here is the abstract, appeared on May, 2011, with the sequel of my studies on the genetic code!:

Castro-Chavez F. The Rules of Variation Expanded, Implications for the Research on Compatible Genomics. Biosemiotics. DOI: 10.1007/s12304-011-9118-0

http://www.springerlink.com/content/u474w265l55h0701

...

If you are interested in the practical development of these rules of variation that I found in the rotating circular genetic code and in my work to improve the stringency of the nucleotide database filters, please let me know. Do you live in Houston and are interested in sponsoring my work? (My personal email is within the title link, thanks!)

ShCherbak and the Code

2010-04-05T11:33:00.000-07:00

To quote important observations by Vladimir ShCherbak:

shCherbak VI. Arithmetic inside the universal genetic code. Biosystems. 2003 Aug;70(3):187-209.

“…one may assume that natural computing can exist as well. For instance, such a computing could be essence of exact gene processing and scrambling (Landweber and Gilbert, 1993; Landweber et al., 2000). If that is the case, some cell organelles should work as biocomputers. Thereby, we have to discover the number systems with which they work.” “…the genetic code is connected more closely to abstract notions of arithmetic than with notions of physics or chemistry.”

The Arithmetical Origin of the Genetic Code

http://www.springerlink.com/content/t85w0h771510j187

http://tinyurl.com/y9w5gfj

“There seems to be but one conclusion: the genetic code is itself a unique structure of arithmetical syntax. The arithmetical syntax is separated from natural events by the unbridgeable gap between the fundamental laws of nature and the abstract codes of the human mind (Barbieri, 2005). Chemical evolution, no matter how long it took, could not possibly have stumbled on the arithmetical language and initialized the decimalization of the genetic code. Physics and chemistry can neither make such abstractions nor fit the genetic code out with them. It seems that the genetic code appeared as pure information like arithmetic did.”

“There is no plausible chemical logic to couple directly the triplets and the amino acids. In other words, the principles of chemistry where not the sought essence of the genetic code”

“The zero is the supreme abstraction of arithmetic. Its use by any alphabet, including the genetic code, can be an indicator of artificiality.”

“The place-value decimal system represented through digital symmetry of the numbers divisible by prime number (PN) 037. This arithmetical syntactic feature is an innate attribute of the genetic code. The PN 037 notation with a leading zero emphasizes zero’s equal participation in the digital symmetry. Numbers written by identical digits are devised by PN 037 x 3 = 111 and 1 + 1 + 1 = 3 and appear regularly [from the figure: 037 x 6 = 222 and 2 + 2 + 2 = 6, 037 x 9 = 333 and 3 + 3 + 3 = 9, 037 x 12 = 444 and 4 + 4 + 4 = 12, 037 x 15 = 555 and 5 + 5 + 5 = 15, 037 x 18 = 666 and 6 + 6 + 6 = 18, 037 x 21 = 777 and 7 + 7 + 7 = 21, 037 x 24 = 888 and 8 + 8 + 8 = 24, 037 x 27 = 999 and 9 + 9 + 9 = 27].”

“The feature not only excites our sensation of beauty but may simplify some computational procedures too. Moreover, decimalization of the genetic code may be a special case of the general computational power of genomics and their molecular machinery. In fact, the only reason for a number system to appear is for arithmetic calculations.”

“In fact, there is no way to write or read any gene when no code is available. Thanks to its immutability, the universal genetic code is the most accurate information messenger from the time of genesis to the present.”

“First, a general and the most forcible argument: it has been found that the genetic code is governed directly by the arithmetical symbol of zero. This striking fact is verified simultaneously by several independent orderlinesses – logical, arithmetical, and semantical… Incidentally, such an acting zero alone might be sufficient to assume an artificial nature of the genetic code.”

“There is a complete set of information symbols utilizing the decimal syntax 111, 222, 333, 444, 555, 666, 777, 888, 999 in the genetic code. Each of these symbols consists uniformly of a carrier (balanced nucleons) and a meaning (the decimal syntax).”

“As a rule, possible consequences of the mutations such as an abrupt change of hydrophobicity are, to some extent, weakened (e.g. Sjostrom and Wold, 1985; Figureau, 1987; Knight et al., 1999).”

“… when amino acids are replaced through mutation the change of hydrophobicity is generally weak, while that of size is strong.”

“If a point mutation occurs, the code amino acids are to a certain extent protected against an abrupt change of their hydrophobicity but not of their geometric size.”

“Arithmetic is the only tool for producing information systems of extremely high efficiency. Life, being an information phenomenon, could use arithmetic for control, integrity, and precise alterations of its genetic texts.”

“One can speculate that some regular arithmetical background may “underlie” genetic sequences without limitation to their biological context. Analyzing its own arithmetic, such background might check, restore, and alter superimposed biological context by means of calculations omitting translation.”

“Almost half a century ago, the idea of chemical evolution determined a stochastic (random) approach to the origin of the newly deciphered genetic code. The molecular machinery of genetic coding revealed however a baffling complexity. It is common practice to criticize the stochastic approach because the likelihood that this machinery could have been produced by chance is extremely low if not negligible. But, on the other hand, the basic premise of the stochastic approach is that billion years and countless natural events could realize, nevertheless, practically impossible things. This vicious circle exists because both these opposing opinions appeal to the same concept – to the assessment of chances of natural events. One needs therefore properties of the genetic code that eliminate any possibility of a dual interpretation or overlapping of the arguments. In these terms, only the facts whose essence cannot be reduced to natural events can solve the original problem. We believe that a part of these facts have been presented and discussed above.”

I just found another compilation on shCherbak's work, by Craig Paardekooper:
http://www.craigdemo.co.uk/circleoflife.pdf
Where it was concluded:

"The existence of such perfect mathematical balance within the genetic code may be taken as evidence of Intelligent Design. As ShCherbak states, the only conceivable way for the summation to have appeared would be by some arithmetical process. Did arithmetic precede life?"

The Fruitfulness of ID Research

2009-11-30T11:48:00.000-08:00

Today (Monday, November 30, 2009), on his 'Recursivity' blog, Shallit states that one paper includes: "a case of inappropriate citation".

His full paragraph:

"10. Fernando Castro-Chávez, "Hepatology Microarrays, antiobesity and the liver", Annals of Hepatology 3 (4) (Oct-Dec 2004), 137-145. Full paper here. A case of inappropriate citation. The only citation to Meyer comes in the final paragraph, which reads "... to better describe the identity and function of genes and genomes, composers of a natural, complex, and precise biological software that as a genetic program, contributes to the healthy programming and the pathological reprogramming of life." The author appears to be an intelligent design advocate. I predict that inappropriate citation -- the bogus insertion of citations to pro-ID papers in irrelevant contexts -- will become more popular in the future, as creationists attempt to bolster their case that ID is scientific."

Here, I want to emphasize that at the end of the Hepatology paper we read: "...a natural, complex, and precise biological software that as a genetic program, contributes to the healthy programming..." (reference 114 *).

Such statement complements the writing at the beginning of the paper, where we read: "The mRNA abundance and its mechanisms of assembly are two complementary areas. Using Intelligent Design models, we can use the analogy of the nucleic acids (DNA and RNA) as being the Software for the building up of proteins, and the proteins as being the Hardware, with the special feature that here, the Software builds up the Hardware and the Hardware plays and modulates the Software. In the case of metabolic pathways, the proteins are sufficiently flexible to become part of the regulatory Software, in a stairway of self-contained types of Hardware: organelles, cells, tissues, organs, organisms, etc."

* Reference 114 is:

Meyer SC. The origin of biological information and the higher taxonomic categories. Proc Biol Soc Washington, 2004; 117(2): 213-239.

Here is a sampler of ten excerpts of Meyer's paper pertinent to the Hepatology paper's context on biological programming:

1 -
"...arises only if the programmer of the model system “tunes” it in..."

2 -
"...this necessary tuning involves an intelligent programmer selecting certain parameters and excluding others--that is, inputting information."

3 -
"A system of interconnected lights governed by pre-programmed rules may well settle into a small number of patterns within a much larger space of possibilities."

4 -
"...agents previously programming the system..."

5 -
"A computer user who traces the information on a screen back to its source invariably comes to a mind--that of a software engineer or programmer."

6 -
"Genetic algorithms are programs..."

7 -
"Dawkins and Kuppers, for example, have developed computer programs..."

8 -
"...these programs only succeed by the illicit expedient of providing the computer with a “target sequence” and then treating relatively greater proximity to future function (i.e., the target sequence), not actual present function, as a selection criterion."

9 -
"...Gilbert et al. (1996) argued that changes in morphogenetic fields might produce large-scale changes in the developmental programs and, ultimately, body plans of organisms. Yet they offered no evidence that such fields--if indeed they exist--can be altered to produce advantageous variations in body plan, though this is a necessary condition of any successful causal theory of macroevolution."

10 -
"Thus, it might be argued that such differences show that early developmental programs can in fact be mutated to produce new forms. Nevertheless, there are two problems with this claim. First, there is no direct evidence that existing differences in sea urchin development arose by mutation. Second, the observed differences in the developmental programs of different species of sea urchins do not result in new body plans, but instead in highly conserved structures."

At the start and at the end of the "Microarrays, Antiobesity and the Liver" paper we read about information in health and disease. Meyer’s paper is focused on molecular information; so, the citation of Meyer's paper as reference number 114 is appropriate.

For Intelligent Design to be more fruitful as a research paradigm, grants need to be awarded to it, even in disregard of ID being the target of a Darwinian "witch hunt", as the equivocal statement of Shallit clearly demonstrates.

Update on Wednesday, December 30, 2009:

Another 'bold' Darwinian, like the one that posted a first comment in this post, wrote on Shallit's post:

"Anonymous said... In case we haven't figured it out, Fernando Castro-Chávez is a creationist. I'm sure he'd say an IDist, but I've seen his website. Also, wasting time on Joe G is just that, wasting time. Best to just ignore him."

However, Joe G really brought "life" to that shallow post, writing amongst many, many other things:

"Joe G said...

Jeffrey,
Do you realize that all you have to do to refute ID is to actually start substantiating the claims of your position?
If you want to talk about fruitlessness you need to look no further than your position.
There isn't any peer-reviewed articles that demonstrate that accumulating genetic accidents can do what they are claimed to have done.
And when you say that ID is a " religio-political charade" you really expose your ignorance.
What religion?
Does ID say who to worship? No.
Does ID say anything about worship? No.
Does ID depend on religious texts? No.
Does ID require a belief in "God"? No.
Does Jeffrey Shallit think his ID ignorance is meaningful discourse? Yes."
Also:
"You don't have an argument only bald assertions.
Artificial life does not correlate to biology.
And Barbara Forrest is a known liar on an agenda.
1- Artificial life was made by man.
2- Anyone who says that ID is religious or ID is Creation is either a liar or on some agenda.
Want to know why?
Because they cannot support their claims. All Forrest can do is make bald assertions.
It appears that is all you have also.
ID does NOT say anything about worship- nothing about who, why, when, where nor how.
ID does not require a belief in "God".
ID does not require the supernatural."
"Takis,
ID is a branch of creationism only to the willfully ignorant.
All IDists are not religious.
I am an IDists and don't care about religion.
I said:
However there isn't any evidence that any amount of mutational accumulation can give rise to useful novel protein machinery and new body plans.
Jeffrey responds with:"A lie. Go read about the Italian mutation."
No new protein MACHINERY there Jeff. And definitely no new body plans.
Changing one protein does not create new protein machinery.
Heck we can't even test the premise that humans and chimps shared a common ancestor- no one knows if the transformations required are even possible.
Jeffrey:"You really have no idea how science works, do you?"
Unfortunately for you I do.
Ya see in science one needs to be able to test one's claims.
And to this day no one on this planet even knows whether or not the transformations required are even possible.
Joe says:
ID does not say anything about worship- nothiung about who, what, where, when nor how.
ID does not say anything about giving service.
ID is not based on any religious doctrine.
ID does not say anything about the supernatural.
ID does not require a belief in "God".
So Jeffrey responds with: "because any being with the causal powers to tweak the fundamental constants of nature - as ID followers claim - must be a god or have god-like powers."
Or just have advanced technology.
So the bottom line is ID is religious if and only if we change the definition of religion.
Got it.
Artificial life was made by man.
Jeffrey (wrote):"World's dumbest argument, Joe."
Why? It is true.
Man made artificial life and man doesn't know enough about biology in order to mirror it.
Jeffrey (wrote): "Every experiment we do was done by people, but that doesn't mean that every natural event studied is the result of intelligent intervention."
No but if man makes something then blind and undirected processes did not.
Jeffrey,
The designer could be "God" and that would not mean ID is religious.
IOW Jeffrey you don't seem to understand the definition of religion.

Some of the links added by Joe G:
http://intelligentreasoning.blogspot.com/2009/06/biological-evolution-what-is-being.html
http://www.newworldencyclopedia.org/entry/Intelligent_design
http://www.trueorigin.org/bacteria01.asp
http://www.chem.duke.edu/~jds/cruise_chem/Exobiology/miller.html
http://www.creationresearch.org/crsq/articles/43/43_3/baraminology.htm
http://www.answersingenesis.org/get-answers/topic/speciation
http://www.discovery.org/a/2735
http://www.discovery.org/scripts/viewDB/filesDB-download.php?id=349
http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=697

Joe G also wrote:

' Other people have also weighed in on this- including John Morris, the president of the Institute for Creation Research:"...While all creationists necessarily believe in intelligent design, not all ID proponents believe in God. ID is strictly a non-Christian movement, and while ICR values and supports their work, we cannot join them." '

And from Andrew Rowell's Blog: http://idintheuk.blogspot.com/2009/12/proof-of-truth-is-in-citation-index.html

A GREAT CRYPTANALYST HAS DIED

2008-08-01T14:23:00.000-07:00

William (Bill) Reed

(1929-2008)

http://www.beatricedailysun.com/articles/2008/08/16/obituaries/doc48a5949f0954b041865802.txt

We are saddened to inform you that on July 30th William (Bill) Reed had died at his 79 years old.

"I finally found the Soviet submarines. It happened by accident. I had been hearing a “scratchy” sound for some time on various monitored circuits, but had passed it over as some kind of an anomaly, a spurious emission ... whatever. It was sort of like a burst of static ... but not quite. Then, one day, I made a sonograph-enlarged picture of a standard Soviet signal which happened to have one of these scratchy sounds almost on top of it. I spread it out and took a closer look. I’ll be damned! It had bauds! Tiny bauds, the most compressed signal that I had ever encountered ... but bauds. It was a man-made signal, and it obviously was not one of ours. Gotcha! It was a burst signal, and it had to be a Russian sub. We fired the recording directly to the National Security Agency, and they were ecstatic!"

Bill Reed.

IN MEMORIAM:

“Bill Reed’s Rocks and Shoals …chronicles his beginnings as a dirt-poor kid saddled with an abusive step-father, yet a boy who later rose to such a prominent position with U.S. Naval Intelligence that he was given the enormously important job of briefing President John F. Kennedy during the Cuban Missile Crisis—a predicament a thousand times more dangerous than the more recently trumped-up “imminent danger” posed by Iraq.

However, thanks to a secret new defense system which could track Soviet submarines in the Caribbean (CODEWORD: BORESIGHT)—and whose efficacy Reed was able to “sell” to JFK—America managed to avoid a potential nuclear conflict without having to shed the blood of a single human being. (Anyone listening in Washington?)

Throughout a life that unreels like a fascinating novel, Reed emerges as a quintessential American, yet one sublimely aware that duty to country should always come second to loyalty to conscience.”

Alejandro Grattan, Chief Editor El Ojo del Lago, Chapala, Jalisco, Mexico.
[Broken link: http://www.garcesbooks.com]

HOW THE SHADOW GOVERNMENT’S U.S. “INTELLIGENCE” PAYS BACK TO THE U.S.A. PATRIOTS

Chapter Eleven

Crucifixion and Resurrection
p. 221-234
“…She (Joyce, then Bill’s wife) went to her bedroom. I made a pallet on the floor. I was emotionally, mentally and physically exhausted, but I couldn’t sleep. I could never seem to be able to sleep lately. Perhaps sleeping pills would help? I found some in the bathroom and took a few. Nothing. Ten minutes later I took some more, and finally become drowsy. It occurred to me that perhaps I had taken too many. Who cares? The world would probably be better off without me. I fell asleep.”

And the telephone rang. It had probably been ringing for some time. I came out of it slowly. I looked at my watch. I had been asleep only some ten minutes. I felt awful. I remember thinking, Alcohol and Guilting is a Killer! Then, Don’t Guilt while Drinking! Somehow that struck me as funny. It was the first thing that I had thought funny for a long time. I answered the phone. It was Pat Webb.

Pat said, “Hey, Man! We’ve been calling all over town trying to find you. Come on over. We need you!”
“What do you mean, you need me?”
“We’re in trouble. No money. No job. Can’t pay the rent. Lot’s of problems. I need a friend, Man. Come on over. We’ve got to talk.”
I said, “Okay, Pat. I’ll be there in half an hour. I’ll bring a bottle.”
Pat said, “Well, that sounds good, but as long as you’re going to the store, could you also bring some food? We haven’t eaten in a week!”
“Sure”

“…I was walking down a corridor in the NSA (National Security Agency) building thinking… everything is going to be just… and I collapsed.”

“… They took me to the NSA dispensary. The doctor examined me, and then asked, “Have you taken any medicines lately? Any pills?”
Without thinking of the consequences, I replied,
“Yes, sleeping pills.”
“How many?”
“To tell you the truth, I don’t remember”
That did it. From that moment on, my fate was sealed… Attached to the doctor’s admission request was a flag “possible suicide attempt.”
“…Whether it was proven suicide attempt or not. I knew that my career in Intelligence work was over. The NSA never took chances. I would never again be trusted with a Top Secret CODEWORD security clearance. And without that, I was out of the spook business.”

“…but the question of my loyalty had to be raised: What had prompted a Golden Boy candidate like Reed, a man practically assured of achieving senior rank, to want to take his life? Guilt? Guilt over what?”
“…Could he be a double agent? Was he possibly a plant? He had volunteered for this work, remember? He hadn’t been selected at random from prior-screened candidates as was the normal route to intelligence work. Damn! We could have been set up; and this sonofabitch knows where the family jewels are stashed!”
“A full-scale investigation into my background was ordered. No stone was to be left unturned… I had completely blanked from my memory the name of the bastard who was assigned over-all responsibility for my investigation, but we have to call him something. “Jones” will do…”
“… The first thing I discovered when I returned to the B.O.Q. (Bachelor Officers Quarters) was the fact that they had entered my quarters and ransacked the place for evidence against me.”

“…Then they proceeded to interrogate everyone I had ever known or communicated with… kindergarten teacher on up. They missed surprisingly few. I began to receive calls from friends all over the world:
What’s your problem?
Are you in bad trouble?
The guy said I wasn’t to tell anyone that he had talked with me. He said the security of the nation was involved. Damn, Reed! What have you done?”
I guess they really worked over poor Olga in Norway; and every other female liaison whose address I had been foolish enough to record. They had photographed everything…”

“… I was being followed, or stalked out, 24-hours a day, day in and day out. I noticed two men parked outside the B.O.Q. entranceway every night, motor running to keep the heater going. I knew they were there to keep tabs on me. Who else? Then I began to observe tail cars on my trips between Fort Meade and Bethesda. I was still on outpatient status and required to check in several times a week to ensure that I wasn’t a backslider.
I started to tabulate the number of cars assigned to me: one, two, three, and four…
At first the changeovers were professional, made at random. But then, as I knew they would, they became conditioned, casual. After almost a month of this, they became sloppy and fell into a routine that made their job easier…”

“I was so cooperative that I went outside and talked with the agents in the night car assigned to me. They wanted no part of that at first, but I finally convinced them that my intentions were pacific… Slowly, over a period of time, I began to gain their confidence, and some sympathy for my situation. Like my day keepers, they began to relax, and view me as an easy target… They had my wife’s apartment stalked out also. She had undergone intensive interrogation, and so had my children. Agents had even followed Pamela and Billy to school, and talked with their teachers. This was too much. I wasn’t angry; I was furious. I wouldn’t be pushed any further.”

“I had given some eighteen years of my life to my country, serving in the best and most conscientious manner of which I was capable… As a reward an agency of my government was treating me as a man already found guilty of some heinous crime, and that implied guilt was rubbing off on my friends and family…”

“…I had noticed that there were a few moments after I made that sharp curve, where I usually lost sight of my tail. My speed had always remained constant, but one morning as I made the curve I speeded up, then turned abruptly in at the back entrance. As I suspected, a puzzled caravan of searchers sailed on by towards the Main Gate… I drove to an alternate out-of-the-way parking lot, took out a pre-packed bag containing extra uniforms, civilian clothing, and everything else that I would need for a week vacation… I walked a roundabout path to the main gate. I was by this time in dress-white uniform. The Marine guard saluted me smartly. I stepped to the bus stop and caught the first bus going anywhere. I just wanted to get out of sight…”

“…the harassment continued: surveillance, parked cars overnight, the tailing. Now they were even following Joyce and the children to the grocery store!”
“… I was sent to be questioned by the first team: CIA H.Q., Langley. I took the polygraph, and was transferred shortly thereafter to an unclassified desk at the Pentagon…”
“One day as I parked in the Pentagon lot, I saw a young agent get out of a tail car and follow me into the building. I waited on a stairway. As he came hurrying along I stepped out from a corner and stopped him with a hand on his chest. I said, “Okay, kid. You want to follow me? Here, take my hand and I’ll lead you to my desk.” The kid came unglued. He stuttered.
“What… who are you? Are you some kind of queer… or somethin’?...” Then he turned and ran back down the stairway. The next day I was re-admitted to Bethesda Hospital…”
“It was obvious that I had been re-admitted to Bethesda just to get me off the street. I was an embarrassment to them. Why couldn’t I slink around looking guilty and frightened like any normal suspect? …”

“…I awaited the verdict from what looked like a hung jury. Somebody (probably Mr. Jones) didn’t want to give up. I had to be guilty of something! CIA once more for polygraphs, more waiting…”
“…On the way out I was stopped by Mr. Jones. He said,
“Lieutenant, you are either the cleanest sonofabitch I’ve ever encountered or the smartest criminal. Whatever the case, I don’t want you to relax too much; I’ll be looking over your shoulder from time to time.”
I replied, “I suppose I can’t prevent that, Mr. Jones, but I will make you a promise. If you ever molest my family again, especially my children, I’m going to look you up, personally. I’ll even do better than that. I’ll take this public. Regardless of what happens to me, I will reveal things that you and your agency have done that I suspect won’t help your career at all. A competent investigator would have cleared me in two weeks, without recourse to harassment. I will embarrass you, and a great many people. Think about that. Don’t relax too much.”

p. 250-251
The Ubiquitous “Jones Boys”
“Yeah, the bastards were still at it. I was sitting in my office at the 32nd St. Naval Station one morning, when I was advised that I had two visitors from that organization (the ONI, “Office of Naval Intelligence”) who wished to speak with me in private. I recognized them as soon as they stepped through the door. Jones’ Boys – or imitations thereof from some other Spook organization. The interview, or rather interrogation, followed the usual lines…
After that interview I had little illusions as to continuing my career in the Real Navy. Nor did I wish to do so. I put in my papers.”

p. 258
“…The Jones Boys were still on my tail. Unnoticed visits to my modest beach house in Rosarito:
Have you had any relationships with “suspect” characters in your “defection” to South of the Border?
Why did you move to Mexico so suddenly?
Have you been contacted by anyone asking questions regarding your work at NSA?
I’m afraid that I wasn’t all that cooperative. I offered them frijoles, tortillas and tequila, but to every other question I simply grinned broadly and asked, “What do you think?”
This really was the last straw. I decided to move further south… bought a beefed-up Buick to pull my house trailer and headed for the “badlands” of Mexico. If the ONI spooks wanted to follow me, fine, but I sure as hell wasn’t going to make it easy on them.”
“I simply could not believe that these idiots still suspected that I was a Soviet agent, or at least a turncoat. If I had been so, I would not be living in an old beat-up trailer in Mexico and drinking cheap tequila… Couldn’t these dumb bastards figure that one out?”

“I was furious! I decided to get as far away as possible. I needed a vacation. I took it, in Puerto Vallarta, Mexico, and it has lasted some thirty-three years.”
“In closing I only want to say that the United States Navy has been good to me. Forget the NSA, CIA and the ONI; they don’t know the difference between a rope, a line, a hawser or a shoestring. And if they ever knew the words Integrity, Service and Honor, they have surely forgotten them completely.”

--------------------------------

Bruce Ivins, another current victim of the "intelligence's stupidity"? (Manipulated by the "Shadow Government", the same one that "planted" faked evidence on 9/11, being the worst fake the TV Fakery of fake "planes" hitting WTC1 and WTC2)

"Ivins' lawyer says his client was totally innocent and that he killed himself because of the FBI's harassment. He was receiving psychotherapy in the weeks before his death and was banned from the premises of his research lab. Yesterday, a spokesperson for Ivins' lab, the U.S. Army Medical Research Institute of Infectious Diseases at Fort Detrick said the agency "mourns the loss of Dr. Bruce Ivins, who served the institute for more than 35 years as a civilian microbiologist." That seems like an unusual thing to say if you believe one of your employees had something to do with an anthrax attack."

Links:

http://news.yahoo.com/s/time/20080803/us_time/theanthraxmysterydeepens

http://www.usatoday.com/news/washington/2008-08-02-398315781_x.htm

http://www.telegram.com/article/20080804/NEWS/808040364

http://www.forbes.com/feeds/ap/2008/08/08/ap5304613.html

Also:

On Tuesday, August 05, 2008 the Associated Press wrote:

http://www.msnbc.msn.com/id/26044996

“In the current case, Ivins complained privately that FBI agents had offered his son, Andy, $2.5 million, plus "the sports car of his choice" late last year if he would turn over evidence implicating his father in the anthrax attacks, according to a former U.S. scientist who described himself as a friend of Ivins.”

The initial wording also includes the next:

“Army scientist Bruce Ivins told friends that government agents had stalked him and his family for months, offered his son $2.5 million to rat him out and tried to turn his hospitalized daughter against him with photographs of dead anthrax victims.
The pressure on Ivins was extreme, a high-risk strategy that has failed the FBI before.”

Then it continues:

“Ivins also said the FBI confronted Ivins' daughter, Amanda, with photographs of victims of the anthrax attacks and told her, "This is what your father did," according to the scientist, who spoke only on condition of anonymity because their conversation was confidential.
The scientist said Ivins was angered by the FBI's alleged actions, which he said included following Ivins' family on shopping trips.”
“The FBI declined to describe its investigative techniques of Ivins.
FBI official John Miller said that "what we have seen over the past few days has been a mix of improper disclosures of partial information mixed with inaccurate information and then drawn into unfounded conclusions. None of that serves the victims, their families or the public."”
“It is unclear how the FBI eliminated as suspects others in the lab who had access to the anthrax. It's not clear what, if any, evidence bolsters the theory that the attacks may have been a twisted effort to test a cure for the toxin. Investigators also can't place Ivins in Princeton, N.J., when the letters were mailed from a mailbox there.”
“Richard Schuler, attorney for anthrax victim Robert Stevens' widow, Maureen Stevens, said his client will attend Wednesday's FBI briefing with a list of questions.
"No. 1 is, 'Did Bruce Ivins mail the anthrax that killed Robert Stevens?"' Schuler said, adding, "I've got healthy skepticism."”

Another magazine (The New York Times) wrote:

http://www.nytimes.com/2008/08/02/washington/02anthrax.html

"Dr. Ivins, a 62-year-old father of two, took an overdose of Tylenol with codeine."

“A lawyer who had represented Dr. Ivins since May 2007, Paul F. Kemp, insisted that Dr. Ivins was innocent and had been driven to suicide by false suspicions… Mr. Kemp said in a written statement, calling the microbiologist “a world-renowned and highly decorated scientist who served his country for over 33 years with the Department of the Army.”
“We assert his innocence in these killings and would have established that at trial,” Mr. Kemp said. “The relentless pressure of accusation and innuendo takes its toll in different ways on different people, as has already been seen in this investigation.””
“Scientists familiar with germ warfare said there was no evidence that Dr. Ivins, though a vaccine expert with easy access to the most dangerous forms of anthrax, had the skills to turn the pathogen into an inhalable powder.
“I don’t think a vaccine specialist could do it,” said Dr. Alan P. Zelicoff, a physician who aided the F.B.I. investigation when he worked at the Sandia National Laboratories in Albuquerque.
“This is aerosol physics, not biology,” Dr. Zelicoff added. “There are very few people who have their feet in both camps.””
“Representative Rush Holt, a Democrat whose district includes the Princeton, N.J., mailbox where investigators believe the letters were mailed, said the F.B.I. should provide a full briefing.
“What we learn,” Mr. Holt said, “will not change the fact that this has been a poorly handled investigation that has lasted six years and already has resulted in a trail of embarrassment and personal tragedy.””

Another Anthrax links:

http://www.youtube.com/watch?v=O7WsSs_-w_U

http://www.youtube.com/watch?v=pFwi0zF4a70

http://video.google.com/videoplay?docid=-6992924640187480034

http://www.youtube.com/watch?v=RbjTKCQjGpU

The Biggest Forensics Thus Far

2006-06-02T18:38:00.000-07:00

I was told that Intelligent Design was very useful, not only to understand the probabilistic aspects of detecting design in nature, but also to study aspects related to the Science of Forensics. For that reason, I think that the biggest forensics thus far has been the tragic events of September 11, 2001. Are we going to be able identify the hand behind the whole operation?

Update, Lynn Margulis, AB, MS, PhD recently wrote:
http://rockcreekfreepress.tumblr.com/post/353434420/two-hit-three-down-the-biggest-lie [Jan. 2010]
http://www.rockcreekfreepress.com/CreekV4No2-Web.pdf#page=6 [same in PDF, Feb. 2010]
An older statement by her:
http://www.911truth.eu/en/index.php?id=1,86,0,0,1,0 [Aug. 2007]

My previous encounter with Lynn Margulis was at my Literature Review on "Putting Limits on the Diversity of Life" Part Four, Number 8 (20. Apr. 2004):

Biosystems. 1983;16(1):57-63. A test of the karyotypic fissioning theory of primate evolution. Stanyon R.“Karyotypic fissioning theory has been put forward by a number of researchers... Most recently, Giusto and Margulis (BioSystems, 13 (1981) 267-302)* hypothesized that karyotypic fissioning best explains the evolution...” “That hypothesis is tested here by comparing the G-banded chromosomes of humans and great apes with eight species of Old World monkeys” “...extensive karyological similarities are not in accordance with, or predicted by karyotypic fissioning. Apparently, karyotypic fissioning is an extremely uneconomical model of chromosomal evolution.”http://www.iscid.org/boards/ubb-get_topic-f-18-t-000034-p-2.html

* Full reference to Margulis's wrong hypothesis: Giusto, J.P., Margulis, L. Karyotypic fission theory and the evolution of old world monkeys and apes. Biosystems. 1981;13(4):267-302. Review.

Seven scientific links related to "The Biggest Forensics Thus Far":

http://www.bentham-open.org/pages/content.php?TOCPJ/2009/00000002/00000001/7TOCPJ.SGM

http://content.onlinejacc.org/cgi/reprint/55/10_MeetingAbstracts/A86.E810.pdf

http://www.springerlink.com/content/f67q6272583h86n4

http://ehp03.niehs.nih.gov/article/info%3Adoi%2F10.1289%2Fehp.1001924

http://content.onlinejacc.org/cgi/reprint/55/10_MeetingAbstracts/A128.E1196.pdf

http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed&cmd=search&term=World%20Trade%20Center

http://www.springerlink.com/content/v85h3565q68387k0

Detecting Intelligent Design in Charred Ashes and in a Petrified Boat

2006-05-18T20:57:00.000-07:00

The Research of Ron Wyatt:

Sodom & Gomorrah 45 minute amazing video (these videos are not so clear):
http://www.pilgrimpromo.com/WAR/realvideo/fullsodom.ram

Detecting the amazing shapes still preserved of Ziggurats, Walls, Statues and housings as well as the Sulfur rain that reduced everything to Ashes and the actual location of the five Cities of the Plain, including Sodom & Gomorrah, narrated by his loving wife (who narrates his other videos as well).

Noah's ark video:

Detecting the pattern of metals in the Ark's Design:
http://www.pilgrimpromo.com/WAR/realvideo/fullnoah2.ram

Beginning the story of the Ark:
http://www.pilgrimpromo.com/WAR/realvideo/fullnoah1.ram

Trees before the flood lacked rings due to an uniform climate and to a constant humidity in the form of vapor. The seasons and the alternate rain and drought started until after the flood. Never rained before the flood.

Index of Wyatt's Articles:
http://www.wyattnewsletters.com/indexartcls.htm

To see more of his videos:
http://www.arkdiscovery.com/listen.htm

Wyatt's critics are as vain as that 13th tribe Khazar that does not even believe in the actual existence of Mount Sinai and only goes by titles and degrees, or the vain criticism of that other money lover lost in the snow (I'm talking about Jammal's dupe, Dr. Morris Jr.):

http://www.tentmaker.org/WAR/Zias.html

You can also enjoy his movie on the Exodus and a tour to his museum by one of his close associates in the next index:

http://www.pilgrimpromo.com/WAR/realvideo/html/index.htm

The Deception of Aaron J. W. Hsueh: Exaggerating Darwin in Molecular Biology

2006-05-01T07:09:00.000-07:00

Thanks to Robert Crowther for his enlightening article entitled:
The Role of Evolution in Biomedical Research is Highly Exaggerated

To complement Crowther's very interesting article (important to read Crowther's article first in order to understand this one), excerpts from the next and most recent article, destroys even further all of that Hsueh's Darwinian bluff:

Pan W, Tu H, Kastin AJ. Differential BBB interactions of three ingestive peptides: Obestatin, ghrelin, and adiponectin. Peptides. 2006 Apr;27(4):911-6 (PDF).

Endogenous compounds, including ingestive peptides, can interact with the blood-brain barrier (BBB) in different ways. Here we used in vivo and in vitro techniques to examine the BBB permeation of the newly described satiety peptide obestatin. The fate of obestatin in blood and at the BBB was contrasted with that of adiponectin. By the sensitive multiple time-regression method, obestatin appeared to have an extremely fast influx rate to the brain whereas adiponectin did not cross the BBB. HPLC analysis, however, showed the obestatin result to be spurious, reflecting rapid degradation. Absence of BBB permeation by obestatin and adiponectin was in contrast to the saturable transport of human ghrelin reported previously. As a positive control, ghrelin showed saturable binding and endocytosis in RBE4 cerebral microvessel endothelial cells. By comparison, obestatin lacked specific binding and endocytosis, and the small amount internalized showed rapid intracellular degradation before the radioactivity was released by exocytosis. The differential interactions of obestatin, adiponectin, and ghrelin with the BBB illustrate their distinctive physiological interactions with the CNS.

Obestatin has an effect in reducing food intake no greater than that of urocortin...

When the stability of the peptide was further tested by HPLC, it was shown that most of the 125I-obestatin was degraded to smaller peptide fragments 10 min after i.v. injection into the circulation (only 14.2% of the total radioactivity recovered 10 min after i.v. injection (A [in the figure]), and nearly 0 at 20 min (B[in the figure]))

...in mice that obestatin is rapidly degraded and does not have specific uptake by the endothelial cells composing the BBB.

In summary, neither obestatin nor adiponectin crosses the BBB by a specific transport system. Obestatin was rapidly degraded in the circulation, but adiponectin was very stable.

Human ghrelin exhibited saturable binding and endocytosis in the RBE4 rat cerebral microvessel endothelial cell line...

So, is currently Hsueh himself promoting this, his own pro-Darwinian study on "obestatin" in his own website? ABSOLUTELY NOT! (check that his last main reference updated is for 2006, while his "Darwinian" paper (from 2005) and other of his Darwinian papers, are not even included within his main papers or within his main description of his "research interests") Why? Does Hsueh secretly recognize that it is extremely bogus to credit and to equate the liar Darwin's ideological frauds with comparative genomics and with molecular biology?

Here is the full PDF of such Hsueh paper, paper overinflated by Hsueh's press conferences as "confirming" the absurdities of "Darwinism"; however, the "more subdued" original version of the paper, as Crowther wrote, indirectly and only passing-by mentions "evolution" (that when real can be understood as "microevolution"), but not as "Darwinism", and here, not even for the main molecule of the paper (obestatin) but for two receptors, and that, as usual, mentioned only as a sheer speculation linked to the fine-tuning of the molecules, see it by yourself in Hsueh's next paragraph:

"Our discovery that obestatin is the cognate ligand for GPR39 suggests that GHSR and GPR39 could have evolved from a common ancestor but diverged in their functions, thus maintaining a delicate balance of body-weight regulation. This scenario is similar to the divergent and sometimes opposing actions of two paralogous corticotropin-releasing hormone receptors and their ligands in the regulation of adaptive stress responses"

Hsueh also mentions "evolution" (that can be understood as "microevolution") once and again, mere speculation, in the legend for a figure on his supplementary material (also in PDF) for this same paper:

"Bioinformatic prediction of conserved obestatin. Based on a computer program previously used to identify unique protein signatures (6), we searched for potential mono- or dibasic cleavage sites in ~200 known preprohormone sequences. Candidate regions were further checked for evolutionary conservation of the putative mature regions in diverse species."

How can Hsueh be so biased and erroneous to fraudulently equate, as most of the atheists within the scientific community do, "microevolution" with the lies of Darwin?

Well, let's see the roots of his deliberate deception, covered here in this blog elsewhere ("The Finch Variation") and demonstrated by a Hsueh's seminar in China:

http://news.ioz.ac.cn/2004/1/FA445971_13DF_496A_951C_376F1F18E20F.html

And even when the main text is in Chinese, you can easily appreciate that in the first slide, where one Chinese student is reading, that the slide at his back reads: "Evolutionary Genomics of Polypeptides, Ligands and Receptors" (again this, when true, can be easily understood as "microevolution", but never as a Darwinian "macroevolution"), then in the next figure we can see Hsueh gesturing and in the third figure finally we have the Darwinian deception, yes, again and again, by the deceptive use of the Galapagos' finches (here is the deceptive and always used "example" of Darwinism directly from that Chinese webpage):So, we see that time after time the atheistic deception of Darwinists is to deliberately blur and confound the clear difference between compatible varieties of animals, exactly like those finches, with the wrong idea of the false "new" origin of genetically incompatible new "species".

The rest of the slides of that Chinese website show different approaches of a deceived audience. That conference was presented by Hsueh in China in January of 2004, while on December 23, and again in China, while others were celebrating their holidays, Hsueh presented the next conference, again and wrongfully pushing his biased "Darwinism" in China, to the extreme "Darwinism in the post-genomic era"

And then again, a biased article by the same Hsueh was published in Chinese:
Aaron J. W. Hsueh. Introduction to evolutionary genomics. Acta Zoologica Sinica. 2004. 50(5):856-8.

"Abstract: Recent advances in the sequencing of all genes in human and diverse model organism have provided a new perspective on biological research. Comparison of the sequences of orthologous and paralogous genes based on their evolutionary origins allows a better understanding of the physiological roles of individual genes. One of the most important aspectsof genomic research is the understanding of the entire gene repertoire, thus eventually allowing a full understanding of gene functions. This article provides some examples of comparative genomic analyses of polypeptide ligands and their receptors. The Chinese name for the emerging field of "evolutionary genomics" – is proposed here in order to emphasize the non progressive nature of the evolutionary process and the global analyses of the complete gene sets in diverse organisms. Key words: Evolution, Genomics."

Here, the calculated deception of Hsueh consists in that his use of the word "evolution" (to support his atheistic Darwinism, as we have seen here) is coupled with the NON-EVOLUTION that we have observed in Molecular Biology, which means that the Conserved Sequences, according to Hsueh's own words, "emphasize the non progressive nature". So, if the nature of the conserved sequences is non progresive that means that they remain stable, under STASIS, performing the very same function in every organism which contains them! The minor variations within the different groups of organisms containing those very similar and conserved secuences can be accounted in terms of 'MICROEVOLUTION' but never in the atheistic fashion envisioned by Darwin (Darwin's linear idea of a never-planned, purposeless and non-directed Universe, which is Darwin's speculation of a false "macroevolution"). So, "the non progressive nature" of the stasis within the Conserved Sequences in Molecular Biology is indeed an intelligent design!

Other papers in which Hsueh mentions the word "evolution" (that can be easily understood, when real, as with the evident diversity of compatible finches, again, as "microevolution"), are:

Orna Avsian-Kretchmer and Aaron J. W. Hsueh. Comparative Genomic Analysis of the Eight-Membered Ring Cystine Knot-Containing Bone Morphogenetic Protein Antagonists. Molecular Endocrinology 18 (1): 1-12.

"Availability of completed genome sequences from diverse organisms allows bioinformatic analysis of the evolution of BMP antagonists and facilitates their classification."

However a related paper by the same author does not mention evolution in its abstract at all!!! (And that is because "evolution" is not necessary at all to do good science):

A J W Hsueh, P Bouchard1 and I Ben-Shlomo. Hormonology: a genomic perspective on hormonal research. Journal of Endocrinology (2005) 187, 333-338.

"Recent advances in comparative genomics allow a new paradigm for hormonal research. At the centennial of the first use of the term hormone by Ernest Starling, we reflected on the changing approaches in elucidating hormonal signaling mechanisms and highlighted the inadequacy of the term endocrinology, implying remote activation, to describe the diverse modes of hormone actions. Several examples were presented to underscore the power of comparative genomics in the identification of new polypeptide hormones, receptors, and signaling pathways. We propose the use of the term hormonology to more accurately reflect the expanding boundaries of the discipline."

Note: Did here, in this previous abstract Hsueh forgot to do his "ideologico-political" statement or what? (smile) What is clear is that in his own words, the use of "evolution" it is not useful to do good and practical science after all!

Early comments on the molecule itself used by Hsueh in his "Darwinian" press conferences (obestatin), can be seen at:
http://onhealth.webmd.com/script/main/art.asp?articlekey=56358

"...there's not much change in body weight, and we don't yet know if fat mass is actually changed... Obestatin may have cut appetite by making the rats "a little sick and therefore a little bit less willing to eat," Tschop [Matthias Tschop, MD] says... Tschop says there are dozens of hormones involved in appetite and probably even hundreds of factors that are known to play a role in energy balance, food intake, body weight, and body composition. "We don't know much yet about which ones are the essential ones and how all of these interact," Tschop says... Obestatin and ghrelin share the same gene. Removing that gene pretty much amounts to a draw. "This might explain why a mouse that's lacking that one gene doesn't seem to be very different from a normal mouse, because you remove at the same time, so to speak, the gas pedal and the brake," says Tschop."

Concluding, is Hsueh the only responsible to deceive the general public by exaggerating Darwin in molecular biology? No, unfortunately not... that seems to be the common "mark" of the current beast of atheism through evolutionism started in biology by Darwin.

Expedition Everest Uncovers New Varieties of Animals

2006-05-01T06:59:00.000-07:00

Sampling of the outlandish critters:

Giant hornets so deadly locals call them "Yak Killers"

Jumping "Yeti" mice

A new grasshopper in which the males hitch piggy-back rides on the females

Baby blue-faced golden monkeys, the region's largest primates

Hamster-like pikas that eat their own feces

Ten new ants to add the more than 11,000 already known... plus a couple of new frogs, eight new insects, etc...

Intelligent Design: Genibo, A Robotic Dog

2006-05-01T06:24:00.000-07:00

S. Korea develops robotic dog 'Genibo'

Koreans unveil speech-recognising digital doggie

Korean Robots Jupiter, Nettoro, Roboid and Genibo Coming This October

Previous Robot:
The Intelligent Design of a Robotic Coelacanth

The Intelligent Design... Of Mound Mountains With Pyramids Inside

2006-04-25T12:57:00.000-07:00

Taken from: http://quezi.com/532 : JianJunTen (General's Tomb), or the "Pyramid of the East," in Ji'an, near the border with North Korea. - courtesy kevsunblush - CC-BY

"There was a time when Chinese pyramids were considered speculation and myth but now we can say, yes, there are pyramids in China. For many years scholars considered chinese pyramids as nothing more than large mounds, but things have changed... Most of the earlier stories were based on the existence of the “Great White Pyramid.” A photo of this pyramid in the Qinling mountains was said to have been taken by Americans in 1945, but it remained in military files for 45 years. Also US Air Force pilot James Gaussman claimed to have seen a white jewel-topped pyramid while flying between India and China during World War II. However, there is little evidence for this claim. Then, In 2000 China stated that there were some 400 pyramids in the Shanxi region. Smaller than the legendary “Great White Pyramid,” these ancient remains have been classified by some as burial mounds. In 2006 it was announced that Chinese archaeologists discovered a group of ancient tombs shaped like pyramids which dated back at least 3,000 years, in northeast China’s Jilin Province. The tombs covered an area of 500,000 square meters and were found after water erosion exposed part of a mountain, revealing two of the tombs. Six smaller tombs had eroded away leaving no clue as to their original size and appearance. But the biggest tomb, located on the south side of the mountain, could clearly be seen as a pyramid shape with three layers from bottom to top.
Some of the pyramids in China are as large as any that can be found in Egypt, Mexico or any other part of the world. However, one of the problems in studying them is that they are most all in a military restricted region and virtually closed off to outsiders. Following is a list of Chinese pyramids that are now recognized. Inner Mongolian pyramid (1 kilometer north of Sijiazi Town, Aohan County)Maoling MausoleumPyramid of Gathering (Tibet)Qin Shi Huang’s mausoleumZangkunchongStep Pyramid (Ziban). However, the elusive “Great White Pyramid” is still among the missing."

(Courtesy of Unjournaled! by Dino Avdibeg from Denmark)

Pyramid found - in the heart of Bosnia!! (Thursday, October 27, 2005)

Of it, 'digger' Slowspin wrote, 180 days ago (with 82 comments, to date):

"The pyramid is 100 metres high and there is evidence that it contains rooms and a monumental causeway... The plateau is built of stone blocks, which indicates the presence at the time of a highly developed civilisation."

The media, never up-to-date, just presented it the next way: Bosnian Town Hopes to Cash in on Pyramid. VISOKO, Bosnia-Herzegovina, Apr. 11, 2006 (CBS News.)

My Comment: When the Conquerors from Spain arrived to Mexico, the natives covered many of their Pyramids with stones and soil... so many of them also remain uncoverend 'till this day, looking something like:

Future holds a great future for ID researchers, most abundantly, in Central and South America, I think... so, ID can help in archaeology. Meanwhile, this work in Bosnia is amazing!

History-laden hill contains human-made tunnels, researchers say

For the last link, Zogger wrote:

"Researchers have started exploration into an elaborate underground tunnel structure found under a large hill in Bosnia. The quite regular shape of the small mountain combined with the discoveries and the old legends that go with the place have lead some to speculate it might be the first true man made pyramid found in Europe. Aerial remote sensing has located two other potential pyramids in the same area."
Many more amazing related pictures can be found at Google Images.

The Exquisite Intelligent Design of Those Petite Organs!

2006-04-25T08:07:00.000-07:00

This new one was uploaded by: metsakos (in album: Chalkidiki, Greece. In: travel. Date uploaded: Sep 14, 2004 http://travel.webshots.com/photo/1187595559035364392IoesBu)

... Like that beautiful little toe that screams to the evolutionists, PLEASE "Don't Touch Me!" (a former picture that was in "The Texture of America!" with that statement painted over the feet at: ttp://imageserver4.textamerica.com/user.images.x/25/IMG_466325/_1203/TZ201203034949717.jpg)
Finding inspired by the writings of Breslin83 in his Intelligent Criticism Blogspot, as well as by his posted link on the writings of Dr. Giovanni J.R. Calla. So, here we are going to be "Understanding the Functional Relevance of the Once Thought Vestigial Organs":

The Changing Definition of the Thymus from a Believed Rudiment into One of the Most Important Organs in the Human Anatomy
http://www.geocities.com/gcalla1/thymus.htm

The Operative Significance Of The Appendix In Normal Systemic Functions
http://www.geocities.com/gcalla1/appendix.htm

Understanding the Functional Significance of the Once Thought Vestigial Tonsils
http://www.geocities.com/gcalla1/tonsils.htm

The Operative Significance of the Supposed Rudimentary Coccygeal Process
http://www.geocities.com/gcalla1/coccyx.htm

The Actual Significance of the Assumed “Junk” Deoxyribonucleic Acid
http://www.geocities.com/gcalla1/junkDNA.htm

In Breslin83's original posting on ‘Vestigial Organs’: A Vestige Of Outdated Science. Series of Essays: Part 1: Humans, we read the next:
"One of the 180 odd vestigial organs alluded to at the Scopes trial: The Appendix does indeed have a function..."
While Dr. Giovanni wrote:

"Initially, there was believed to have been at least 180 rudimentary or vestigial organs in the human body. However, this count has dwindled to approximately 14 structures. These structures are as follows: the adenoids, the APPENDIX, body hair, the COCCYX, the ear muscles, the little toe, the nictitating membrane of the eye, the nipples on males, the nodes on the ears, the parathyroid, the pineal gland, the thymus, the TONSILS, and lastly, the wisdom teeth... some relatively larger animals that are evolutionary linked to the hominid species do not have such vestigial organs at all and yet are perceived to be less developed (evolutionarily speaking) than the presently remaining representative of the order hominidae. Furthermore, some smaller animals that are also believed to be related to the above larger mammals do carry most if not all the said vestigial organs. Thus, upon reviewing this idea, there is therefore no logical pattern in the supposed eventual disappearance of these structures in more advanced organisms... Thus, through many separate research studies and experimentations, most if not all allegedly useless structures in the body are now found to have different tasks and serve extremely important purposes in the body on either insuring over-all structural stability or the assurance of appropriate processing of various internal functions."

Not to subestimate the aesthetic and spatially vital importance and beauty of such "petite organs"!

So, my very dear reader, please don't let those atheistic evolutionists and those living fossils of darwinism to cut off your own and beautiful little toes!

http://gorgeousfeet.textamerica.com/?r=3799050 (Quick time viedo of a gorgeous female little toe, courtesy of Gorgeous Feet, smile)

Or even the worst, please don't let those atheistic evolutionists and those living fossils of darwinism to slander you and to cut out your OWN SOUL!!!

In brief, don't let'em fools fool you anymore!

Intelligent Design In Cryptography: The Enigma Encryption Machine

2006-04-24T12:56:00.000-07:00

Enigma machine's products decrypted by TICOM (Target Intelligence Committee).

Lönnig wrote:

"...Dembski has proposed and elaborated the term “specified complexity” by incorporating five main factors to guarantee its applicability not only to diverse human branches of research (e.g. forensic science, cryptography, intellectual property law, random number generation, insurance claim investigation, archaeology, SETI), but also to the origin of species and higher systematic categories..."

To decode a hidden message is as exciting as to interpret a 'new' archaeological puzzling language or to understand the translation of DNA into 'new' Peptides and Modular Proteins!

Related Links:

The United States National Cryptologic Museum (also go there to external links, for example).

Operation Paperclip (a.k.a., Project Paperclip and Operation Overcast)

Operation Alsos (see its missions) and sub-operations: Operation Big and Operation Harborage.

Operation Epsilon

Operation Stella Polaris

Also see in this site:

Decoding Intelligence, Joerg Arnu and Clark

Intelligent Design in Archaeology and in Biology

The Maya and Archaeological Decoding

Common Patterns in the Ancient World, their Pyramids and gods

Three Rivers and Six Fingers Thrice

Science Magazine Publishes a Paper to Oppose Irreducible Complexity (IC)

2006-04-21T07:39:00.000-07:00

Long time ago I wrote that the materialists controlling science were in so an extreme paranoia that they will allow the publication of any article to oppose Intelligent Design, no matter how biased it should be.

Naturalistic philosophers in control of the current mainstream science journals are using the "ill-oriented philosophy" of publishing anything opposing Intelligent Design (ID) while at the same time blocking the publication of articles supportive of ID.

Originally I wrote what 'Science' is now confirming [Re: Wall St Journal on Rick Sternberg. 02/01/05]:

"...to write peer-reviewed papers to refute Intelligent Design and Creationism without having allowed BEFORE the publication of any Intelligent Design or Creationism peer-reviewed paper, is an inexcusable shame for the scientific community of today!"

Is the next scenario evidence of soundness of mind or rather reflects the pathology of evolutionism?

1- The logic of the scientific community of today is that "To publish peer-reviewed articles on "Intelligent Design" or on "Creationism" is forbidden, because both are against 'the soundness of science.' However, to publish peer-reviewed articles against "Intelligent Design" or against "Creationism" is, oh yes, that is "very scientific", and is allowed, indeed, encouraged!"

2- "Intelligent Design" is not science; however, to beat "Intelligent Design" is science indeed.

3- You are forbidden to publish in indexed journals your experimental results, theories and observations based on "Intelligent Design", but you are encouraged to publish anything you want against "Intelligent Design".

That is how the scientific community and the establishment are infested today with the pathological state of mind of evolutionism/darwinism!"

Then, I concluded:

"...I dream in a time in which you could be able to freely do good research, and publish it, no matter if you deeply reject the materialistic and biased assumptions, or I must say "impositions" of current evolutionism and darwinism."

Well, now Science magazine has joined such irrational flock of publishing opposition to ID before the publishing of any peer-review supporting ID. So, Who are those atheist authors and publishers fighting against? Are they fighting a ‘non-existing’ concept in their peer-reviewed journals? A concept (IC) published in a book (Behe's 'Black Box') that is so important to the real science that in order to oppose it, the "God-is-not-allowed" establishment 'escalates it' [IC] to the foremost 'prestigious' scientific journal on earth? Once more, the atheistic paranoia has 'escalated' to the point of confirming that for them, "beating ID is 'science' but supporting ID is 'not science at all'..."

So, did 'Science' published a paper on micro-evo to try to endorse macro-evo, or what...? If that's the case, that's just Darwinism at its very beast! (smile)

Let's check the facts to see how the IC and ID microevolutionary fact of antibiotic resistance-like modifications is now being 'ill-used' by evolutionists to try to oppose IC... Debating a controversy that 'does not exist' according to the outdated NCSE and its blind flocks at the AAAS, at the Smithsonian, etc... (including those atheists at National Geographic, at Scientific American, etc.)

On reviewing the case, Denyse O'Leary wrote: "Science and other sci mags are trying to take out intelligent design by flogging up a study that they claim disproves the ID concept of irreducible complexity [Dr. M. Behe's proposal]."

Dr. Michael Behe, the ID concept's author, has replied, of course with his article entitled: "The lamest attempt yet to answer the challenge Irreducible Complexity poses for Darwinian evolution."

Here are some of those comments by Dr. Behe:

"The authors [Jamie Bridgham, Sean Carroll and Joe Thornton, including Christoph Adami in his commentary] are conveniently defining “irreducible complexity” way, way down. I certainly would not classify their system as IC. The IC systems I discussed in Darwin’s Black Box contain multiple, active protein factors. Their “system”, on the other hand, consists of just a single protein and its ligand. Although in nature the receptor and ligand are part of a larger system that does have a biological function, the piece of that larger system they pick out does not do anything by itself. In other words, the isolated components they work on are not irreducibly complex... In the experiment just two amino acid residues were changed! No new components were added, no old components were taken away... Nothing new was produced in the experiment; rather, the pre-existing ability of the protein to bind several molecules was simply weakened. The workers begin their experiments with a protein that can strongly bind several, structurally-very-similar steroids, and they end with a protein that at best binds some of the steroids ten-fold more weakly... Such results are not different from the development of antibiotic resistance, where single amino acid changes can cause the binding of a toxin to a particular protein to decrease (for example, warfarin resistance in rats, and resistance to various AIDS drugs). Intelligent design proponents happily agree that such tiny changes can be accomplished by random mutation and natural selection.... Although the authors imply (and Adami claims directly) that the mutated protein is specific for cortisol, in fact it also binds aldosterone with about half of the affinity. (Compare the red and green curves in the lower right hand graph of [their article's] Figure 4C.) What’s more, there actually is a much larger difference (about thirty-fold) in binding affinity for aldosterone and cortisol with the beginning, ancestral protein than for the final, mutated protein (about two-fold). So the protein’s ability to discriminate between the two ligands has decreased by ten-fold... One would think that the hundred-fold decrease in the ability to bind a steroid would at least initially be a very detrimental change that would be weeded out by natural selection. The authors do not test for that; they simply assume it wouldn’t be a problem, or that the problem could somehow be easily overcome. Nor do they test their speculation that DOC [11-deoxycorticosterone] could somehow act as an intermediate ligand. In other words, in typical Darwinian fashion the authors pass over with their imaginations what in reality would very likely be serious biological difficulties... The fact that such very modest results are ballyhooed owes more, I strongly suspect, to the antipathy that many scientists feel toward ID than to the intrinsic value of the experiment itself... In conclusion, the results (and even the imagined-but-problematic scenario) are well within what an ID proponent already would think Darwinian processes could do, so they won’t affect our evaluation of the science. But it’s nice to know that Science magazine is thinking about us!"

Update:

On April 20, 2006, at 09:20 AM, Bruce Chapman Posted:
Now That Science Magazine Recognizes That Behe's Theory of Irreducible Complexity Is Science, Will They Let Him Respond?

The contention that biochemist Michael Behe's intelligent design argument of "irreducible complexity" (IC) is not science was undercut in a recent issue of Science magazine which contains a paper purporting to falsify the theory.

If it's not science, why bother to try to falsify it? Further, the hapless case made against Behe’s theory--as Dr. Behe explains in his detailed response--shows that irreducible complexity is also good science.

Unintentionally, this paper in Science puts the lie to the whole line used in the Dover trial against Behe and his theory of irreducible complexity. It will be interesting to see whether Science lets Behe reply to the Thornton paper in its pages.

If you can't find it [Behe's Response Printed] in Science, you can read it elsewhere [i.e., Previous Link]. Here's a page with links to several articles about irreducible complexity.

Also see that the deceptive nature of such paper published in Science used a "Step One. Find something that is not irreducibly complex, and explain that, sort of". Also see Paul Nelson's "Debating the Controversy That Doesn't Exist" (smile)

Macroevolution, The Overselling of a Speculation

2006-04-18T08:21:00.001-07:00

Dear Stu,

In your comment (# 5) you declare that for you, macroevolution is a non falsifiable inference instead of being a mere speculation, as I held it to be.

First, it must be said that for staunch evolutionists the word "macroevolution" doesn't exist! They don't want even to allow us to dissect their fiction from reality!

However, the evidence indicates that every living organisms considered by evolution as diverging into two separate and non-compatible groups of organisms (their speculated "speciation") are indeed compatible varieties of organisms able to interbreed (a compatible variation)!

The evolutionary overselling and distortion of reality that I have been denouncing here is precisely that specific aspect of a biased evolutionary theory (fact that can be verified by my posting on Laupala compatibility where initially S.C. clearly exposed how the (and his) atheistic philosophy is currently biasing biology).

You can easily see that biased evolutionists still use Archaeopteryx as their icon of an extinct and non-granted or false "speciation", as the mythical intermediate between reptilian dinosaurs and birds... read those lies by yourself:

"Dr. Novacek [Michael J. Novacek, a paleontologist at the American Museum of Natural History in Manhattan] responded: "We've got Archaeopteryx, an early whale that lived on land, and now this animal showing the transition from fish to tetrapod. What more do we need from the fossil record to show that the creationists are flatly wrong?" ... "Dr. Shubin [Neil H. Shubin of the University of Chicago plus Edward B. Daeschler of the Academy of Natural Sciences in Philadelphia and Farish A. Jenkins Jr., a Harvard evolutionary biologist], an evolutionary biologist, let himself go... Tiktaalik is so clearly an intermediate "link between fishes and land vertebrates" ...it "might in time become as much an evolutionary icon as the proto-bird Archaeopteryx," which bridged the gap between reptiles (probably dinosaurs) and today's birds."

And who is behind such "calculated" lies?

"The science foundation [the National Science Foundation] and the National Geographic Society were among the financial supporters of the research."

However, Archaeopteryx today is fully considered as a bird. Let me recap with you the next references:

Alonso PD, Milner AC, Ketcham RA, Cookson MJ, Rowe TB. The avian nature of the brain and inner ear of Archaeopteryx. Nature. 2004 Aug 5;430(7000):666-9. Archaeopteryx, the earliest known flying bird

Burish MJ, Kueh HY, Wang SS. Brain architecture and social complexity in modern and ancient birds. Brain Behav Evol. 2004;63(2):107-24.
Archaeopteryx, an ancient bird

Zhang F, Zhou Z. Palaeontology: leg feathers in an Early Cretaceous bird. Nature. 2004 Oct 21;431(7011):925.
the earliest known bird, Archaeopteryx

Chatterjee S, Templin RJ. The flight of Archaeopteryx.
Naturwissenschaften. 2003 Jan;90(1):27-32.
bird, Archaeopteryx

Below of my original posting for those references, you can see the answer of Neil A. Wells, an atheist and evolutionist, like all of those "S" guys that have been posting here (Smile):

"Sorry, I wasn't very clear about the status of Archaeopteryx... Archaeopteryx has precisely "average" wing geometry (aspect & loading) relative to modern bird wing types."

Do you want to remember a previous hoax perpetrated by National Geographic? Check on the Archaeoraptor Liaoningensis: Fake Dinosaur-bird ancestor

Want to check something about The Overselling of Whale Evolution?

[?] Want to see something scholarly oriented related to the classic Piltdown Fraud: Available Evidence Reviewed. Weiner and Oakley. American Journal of Physical Anthropology March 1954.

The same can be said of any other myth for an extinct "speciation", you can check it by yourself about the very alive one: The Coelacanth. And the many varieties of it that still are being discovered today and today and tomorrow! (smile).

The same can be said of: The Australian Lungfish and its varieties.

The same can be said of: The African Lungfish and its varieties.

How long it will take to demonstrate that Tiktaalik is another example of a false evolutionary overselling of a non-existing event of an extinct "speciation", exactly like the Coelacanth and the Lungfish were before?

PS:

Coelacanth fossils have even been found in Kansas by Pam Everhart in 1990, the subject of a presentation (Stewart, J.D., et al., 1991) at the annual meeting of the Society of Vertebrate Paleontology and the Kansas Academy of Science annual meeting in 1995.

Lung Fish fossils have been found in Quebec, Canada as reported to the Canadian Journal of Earth Science 24: 2351–2361.

Update: Next, an important related statement by Andrew Rowell, from his posting "Macro-evolution as religious doctrine":

"A much wider audience has learned that some supposedly objective scientists who are only concerned with “facts” actually have a deeply emotional and what could accurately be described as a “religious commitment” to macro evolution as the central dogma of naturalism. This emotional and “religious” commitment extends well beyond the realm of facts and functions in a way analogous to any organised religion."

And for those atheists reading this posting, go to: Atheism/secularism a religion and A. Rowell's most recent one: Secularism one religious viewpoint?

The Intelligent Design of a Robotic Coelacanth and of a Cartoonic Lungfish

2006-04-18T08:21:00.000-07:00

Incredible Aquarium Fish Robot
Swims Just Like the Real Thing.
Terada Yuji holds a robotic fish that closely resembles a real coelacanth. Terada developed this silicon resin fish, and says that a lot of difficult research went into making it.

"Funky Lungfish"

"My pet Lungfish was the inspiration for my character design. I wanted to do an appealing character so I chose a popular culture to base him on. I chose hip hop. The character's attributes are: smooth, greedy, cool and odd. This was the recipe to my design [Joe Watson © copyright 2003]"

Specialized Book on Obesity Published in Spanish

2006-04-14T15:27:00.000-07:00

A specialized book on obesity (a book in Spanish) was published, see for example its chapter:

Castro-Chávez, Fernando. Genes Implicados en la Susceptibilidad a Obesidad y Genes Antiobesidad (pp. 63-94). In: Méndez-Sánchez N y Uribe M. Obesidad. Conceptos Clinicos y Terapeuticos. Elsevier Masson-Doyma, México 2005. 470 pp.

It is in Spanish but a relevant fragment of it has been translated by me here.

This was its public presentation:

http://www.inmegen.gob.mx/index.php?option=com_content&task=view&id=275&Itemid=155

My Response to Atheist Sean C.

2006-04-13T09:10:00.000-07:00

Like every other typical atheist involved in messing with biology, what atheist Sean C. wrote is in >: [for a sad and purposeless face (smile)]

>: I had to laugh when I read this blog.

Sean, thanks for reading the blog. Remember that the one that laughs the last laughs the best.

>: As a bona fide evolutionary biologist...

"bona fide" means "in good faith", "acting without the intention of defrauding", so, what do you mean here, oh Sean?

Do you mean that by being "evolutionary biologist" you are an atheist philosopher blinded to everything that counters a speculative macroevolutionary biology currently shaped a la Darwin?

>: I'm constant amused by the time and effort creationists expend trying to debunk evolutionary studies.

Even thought Intelligent Design is not "creationism", creationists and anyone else are rightfully entitled to debunk baseless speculations sold as "proof" for a speculative and macroevolutionary "closed" worldview.

To point out the precision of a real microchange (call it microevolution) versus an ideological and baseless speculated macrochange (call it macroevolution) it is a legitimate scientific endeavor, always ignored by the ideologues of materialism such as Sean C.

Please Sean, don't you run like every other materialistic darwinian evolutionist which ever posted here... I need to ask you: Do you think that under the current dominance of Darwinism in biology we already have an adequate identification of biological varieties in nature? My own answer is a sounding NO!

Sean, are you blinded not to see that what is currently sold as examples of "speciation" are indeed examples of variation within compatible groups of organisms, hence microevolution is fraudulently being sold as macroevolution by "bona fide" atheistic "evolutionary biologists", er, pseudo-philosophers like you, Sean? That's SAD!

>: Sad.

Yes, sad is Sean's atheism blinding his "objectivity" as when he writes the very next line:

>: Better to ask, what would it matter if God didn't exist?

Well, Sean, by your choosing you can live very empty in your closed worldview and then, at the end, just to wait to die uneventfully. What would it matter to you anyway, oh Sean? However, it is very clear that your atheism is biasing all your possible science, if any.

Sean, your writing demonstrates that you are only an atheist philosopher attempting to put some of your poison on the minds of objective scientists.

Sean, is it not plausible and testable the precise identification of biological varieties and the consequent generation of new biodiversity that we are proposing here? By your atheistic thumb, supposedly this pursuit is not scientific.

>: I would have thought that the recent landmark decision against intelligent design in Pennsylvania would make you folks take a step back and actually think.

Sean, you evidently are not an objective scientist but an atheistic philosopher and a baseless politic. Intelligent Design researchers are not affected at all by biased decisions not to think! You need to consider that the rigorous identifying of biological compatible varieties and the consequent generation of new biodiversity is science indeed.

>: Carry on, however, it makes little difference.

It really makes a Universe of difference for the minds of thinking people!

>: Cheers

Sean, answer the points that here I posted in bold.

PS,
Teleologist declared: "What Hunt and other religious Darwinists are so adept at doing is take minute changes over time and make leaps of faith to macro changes." More comments on the deception of macroevolution as well as here.

Interesting postings here, here, here, here, here, here, here, and here.

----------------------------------
Scott E. Page (pangloss, a Prof. of Complex Systems, Political Science, and Economics at U. Mich. attempted to ridicule the statement:
"The discovery of genes expressed only in particular organisms or species (“species specific genes”) can be emphasized as a product of intelligent design, as these are not present in any other organism, discarding a continuous evolutionary way of transmission of genetic material, and enforcing the discontinuous, nonlinear origin of the genomic organization of living beings."
Then, Page went after the statement: "For example, the human genome contains at least 223 genes that do not have "the required predecessors on the genomic evolutionary tree", never transmitted "vertically"."
http://www.freeratio.org/thearchives/showthread.php?t=79771
The original number of 223 genes not found in primates was written in three places:
1- Initial sequencing and analysis of the human genome. International Human Genome Sequencing Consortium. Nature. 2001. 409, 860-921.
http://www.nature.com/nature/journal/v409/n6822/full/409860a0.html
“An interesting category is a set of 223 proteins that have significant similarity to proteins from bacteria, but no comparable similarity to proteins from yeast, worm, fly and mustard weed, or indeed from any other (nonvertebrate) eukaryote.”
2- The Human Genome, Elizabeth Pennisi. Science. 16 Feb 2001. 291(5507): 1177-1180.
http://cmbi.bjmu.edu.cn/news/0102/44.htm
"Another head-scratching discovery, made by the public consortium, is that the human genome shares 223 genes with bacteria--genes that do not exist in the worm, fly, or yeast"
3 -
Microbial Genes in the Human Genome: Lateral Transfer or Gene Loss? Steven L. Salzberg, Owen White, Jeremy Peterson, Jonathan A. Eisen. Science. 8 June 2001. 292(5523):1903 – 1906.
http://scienceonline.org/cgi/content/full/292/5523/1903
“223 bacterial genes have been laterally transferred into the human genome” and “In the analysis used to support the claim that 223 genes have been laterally transferred into human.”
The 2001 reported 223 non-linearly transmitted genes were re-visited in at least two places:
4 –In the 2 August 2001 correction: Initial sequencing and analysis of the human genome. International Human Genome Sequencing Consortium. Pages 565-566:
“Extensive sequence data from many additional organisms will be required to assess definitively the provenance of each gene.”
5 - In 2003 Steven L. Salzberg in his power point presentation (Genome Paleontology: Discoveries from complete genomes) declares:
“Our re-analysis finds just 41 genes (Ensembl) or 46 (Celera) with best hits to bacteria – not 223… At least 3 have already been found in Drosophila, 10 more in other species.”
http://www.cs.rpi.edu/~zaki/Workshops/BIOKDD03/Salzberg-Talk.ppt
6-Meanwhile a 2008 staff blogger wrote in "Figuring Out The Role Of Human-Specific Genes" that "There are around 23,000 genes found in human DNA but perhaps 50 to 100 that have no counterparts in other species."
http://www.scientificblogging.com/news_releases/figuring_out_the_role_of_human_specific_genes
7 - In the most recent paper dealing with this information:
"The three genes reported here are the first well-supported cases of protein-coding genes that arose in the human lineage and are not found in any other organism," Knowles and McLysaght concluded. "It is tempting to infer that human-specific genes are at least partly responsible for human-specific traits and it will be very interesting to investigate the functions of these novel genes."
http://www.genomeweb.com/informatics/irish-researchers-sleuth-out-unique-human-genes-originating-non-coding-dna
"Based on these findings, the team estimates that about 0.075 percent of human genes — roughly 18 of the 24,000 — are human-specific and arose from formerly non-coding sequence."
http://www.physorg.com/news171051139.html
"The authors also note that because of the strict set of filters employed, only about 20% of human genes were amenable to analysis."
More information: Knowles DG, McLysaght A. Recent de novo origin of human protein-coding genes. Genome Res. 2009 Oct;19(10):1752-9., doi:10.1101/gr.095026.109
http://genome.cshlp.org/content/19/10/1752.full
So, we do research because there are innumerable things that we are still ignorant of. Here Scott needs to remember the title words on the book that he himself wrote: "The difference, how the power of diversity creates better groups, firms, schools and societies"...
Salvador wrote:
"Secondary pupils in Northern Ireland are spearheading a campaign to introduce a scientific concept, banned in the United States, into the curriculum. Students from both secondary schools and some of the province’s most prestigious grammar schools claim that so-called intelligent design will give a “more balanced view of how the world came into being”."

Antiobesity: Good Nutrition and Exercise

2006-03-15T13:13:00.000-08:00

Willing to contribute a little in the fight against obesity, specially in the U.S.A. I want from time to time to include encouraging stories of real people overcoming severe obesity.

Consider it as a praise of Intelligent Design for an amazing human plasticity to the point to reshape our bodies and minds.

The first and foremost example is that from Arkansas R. Governor Mike Huckabee.

The video of his transformation can be seen at:

AETN's 'Fighting Fat' kicks off 2005 season
February Episode Streaming Clips: Fitness Witness, Gov. Huckabee.

The Cover and first pages for the Book that he wrote can be seen next:

Quit Digging Your Grave With A Knife And Fork: A 12-stop Program To End Bad Habits And Begin A Healthy Lifestyle, Mike Huckabee. 162 Pages. Warner Books Inc. 1st Edition. May 2005.

Some articles related to Gov. Huckabee's amazing transformation:

The Politics Of Weight Loss: Gov. Huckabee's Crusade, by John McGran, eDiets Editor-in-Chief. Updated: February 28, 2006.

Governor's healthy state. By Kathy Kiely, USA TODAY. Updated 7/11/2004 8:56 PM

United States. Arkansas and the presidency. Mike Huckabee's dream. Preacher, guitar-player, erratic dieter: ideal White House material? Jul 14th 2005 LITTLE ROCK
From The Economist print edition.

Governor slims down with ho-hum routine. The Oakland Press. Monday, April 26, 2004.

CBC MARKETPLACE: YOUR HEALTH » FAT GRADE. Measuring fat: Arkansas' plan to get kids fit. Broadcast: October 17, 2004.

A 'Culture of Health'. Arkansas Gov. Mike Huckabee has put his state on a fitness regimen. Can he do the same for America? Brent Humphreys / Redux for Newsweek. Oct. 3, 2005.

Getting religion about health. Mike Huckabee, Arkansas' newly skinny governor, weighs in on the humilation of being fat, why government shouldn't police our grease, and whether he's planning to diet his way to the White House. By Katharine Mieszkowski, May 28, 2005.

Marine Core Marathon print page. Walter Bortz, MD greets Governor Mike Huckabee after completing the Marine Core Marathon.

Other books by Gov. Huckabee:

Living Beyond Your Lifetime: How to be Intentional About the Legacy You Leave.

Character Is the Issue: How People With Integrity Can Revolutionize America. By Mike Huckabee, John Perry [in the very first page Gov. Huckabee contrasts himself from the perjuror from Arkansas]

Kids Who Kill: Confronting Our Culture of Violence. By Mike Huckabee, George Grant

Other encouraging videos of people (from the young to the elderly) winning the fight against obesity as well as easy exercises and a diet to start, can be seen at: http://www.aetn.org/fightingfat

Specially encouraging is the award winning fitness program from Arkansas High Schools:

http://video.aetn.org:8080/ramgen/fightingfat/fightingfat302cbf.rm

You may as well want to see the video of Andy Core in which he shares the motivational story of his own mother, an ex-smoker that gained a lot of weight and her efforts to get fit to the point to participating in several races:

http://www.andycore.com/videos/default.php

So, eat healthy and let's get moving!

Liquid Water on the Outer Space

2006-03-10T07:59:00.000-08:00

Liquid water on Saturn moon... Cassini spacecraft sees signs of geysers on icy Enceladus (videos and slide shows included). The original site, from NASA.

Doesn't that picture looks as if this moon and most specially our own moon were bombarded in the past by an outer space rain in the form of big comets or semi-melted comets?Far Side of the Moon.

I have always been interested in the findings of water in the outer space. Can you imagine our own Universe as a gigantic cell in suspension?

To see a great artistic rendition of our small Universe swimming like a cell inside the infinite waters of the Macrospace, go to Teleological.

Water in the Moon
Moon Water... in reach of human explorers

Water in Mars
Mars Reconnaissance Orbiter Follows the Water

Water in Europa, Jupiter's moon
Jupiter's Tantalizing Moon ...Under the Ice of Europa

An Orbit of Frozen Water, like giant ice cubes, Pluto and the Kuiper belt, source for comets:
Pluto: The Ice Planet
Pluto and Charon : Ice Worlds on the Ragged Edge of the Solar System
Icy World Beyond Pluto
Huge rock-ice body circles Sun
Dr. Comet [Fred Whipple], 95, still hunting space ice boulders
Small Water Comets?
A Taste for Comet Water

Water forming Nebulae
Water fountains in the sky
Stellar Water Fountain May Shed Light on Nebula Formation

From the Space Infrared Telescope ISO, European Space Agency
Cosmic water traced by Europe's space telescope ISO

Etc...

"Cosmological Considerations On The General Theory of Relativity" ["Kosmologische Betrachtungen Zur Allgemeinen Relativitätstheorie," Sitzungsberichte der Preussischen Akademie der Wissenschaften, 1917]. Albert Einstein.

"...the universe according to Newton is finite... The Boundary Conditions According to the General Theory of Relativity... The universal continuum in respect of its spatial dimensions is to be viewed as a self-contained continuum of finite spatial (three-dimensional) volume... both the general postulate of relativity and the fact of the small stellar velocities are compatible with the hypothesis of a spatially finite universe... If we assume the universe to be spatially finite... it follows that the curvature of the required space must be constant... the required finite continuum... will be a spherical space... The curvature of space is variable in time and place, according to the distribution of matter, but we may roughly approximate to it by means of a spherical space... It is to be emphasized... that a positive curvature of space is given by our results...

"Do Gravitational Fields Play An Essential Part In The Structure Of The Elementary Particles Of Matter" ["Spielen Gravitationsfelder im Aufber der materiellen Elementarteilchen eine wesentliche Rolle?", Sitzungsberichte der Preussischen Akademie der Wissenschaften, 1919]. Albert Einstein.

"...As I have shown in the previous paper, the general theory of relativity requires that the universe be spatially finite... As in the preceding paper I shall again show that with a uniform distribution of matter, a spherical world is compatible with the equations... curvature scalar in the three-dimensional space... our fundamental equations permit the idea of a spherical universe …it is known (Cf. H. Weyl, “Raum, Zeit, Materie,” § 33) that this system is satisfied by a (three-dimensional) spherical universe... spherically symmetrical..."

Relativity: The Special and General Theory. Albert Einstein. 1920. Methuen & Co Ltd. First Published: December, 1916. Translated: Robert W. Lawson.

"... the results of calculation indicate that if matter be distributed uniformly, the universe would necessarily be spherical (or elliptical)... quasi-spherical... necessarily finite... Hubble showed, by a special investigation of the extra-galactic nebulae ("milky ways"), that the spectral lines emitted showed a red shift which increased regularly with the distance of the nebulae. This can be interpreted in regard to our present knowledge only in the sense of Doppler's principle, as an expansive motion of the system of stars in the large — as required, according to Friedman, by the field equations of gravitation. Hubble's discovery can, therefore, be considered to some extent as a confirmation of the theory..."

The Meaning of Relativity. Albert Einstein. 1921. The Stafford Little Lectures. Princeton University Press.

"Finiteness of the Universe... If a portion of a surface is observed by the eye to be practically plane, it does not at all follow that the whole surface has the form of a plane; the surface might just as well be a sphere, for example, of sufficiently large radius... The possibility seems to be particularly satisfying that the universe is spatially bounded and… is of constant curvature, being either spherical or elliptical... a closed surface… this idea of Match’s corresponds only to a finite universe, bounded in space, and not to a quasi-Euclidean, infinite universe. From the standpoint of epistemology it is more satisfying to have the mechanical properties of space completely determined by matter, and this is the case only in a space-bounded universe... there is a finite mean density of matter in the universe"

Spherical or Elliptical, the equations of Albert Einstein demonstrated that the Universe is Confined, Finite, Circumscribed, Within a Boundary! Being the Universe as the bodies circumscribed within it, and like their orbits. Hubble complemented Einstein by showing the universe as an expanding, confined balloon. The Bible describes this expansion of the Universe as God extending his tent...

But, how far were the ancient Bible Scholars, when based only on the Bible?

THE WATERS ABOVE THE HEAVENS:

Gen 1:6-7

“And God said, Let there be a firmament in the midst of the waters, and let it divide the waters from the waters. And God made the firmament, and divided the waters which were under the firmament from the waters which were above the firmament: and it was so.”

Ps. 148:4, 6a

“Praise him, ye heavens of heavens, and ye waters that be above the heavens… He hath also stablished them for ever and ever…”

Job 37:18

“Hast thou with Him spread out the sky?”

John Gill says,

"... Mr. Gregory (in his Notes and Observations, &c. c. 23. p. 110, &c.) is of opinion, that an abyss of waters above the most supreme orb is here meant; or a great deep between the heavens and the heaven of heavens, where, as in storehouses, the depth is laid up; and God has his treasures of snow, hail, and rain, and from whence he brought out the waters which drowned the world at the universal deluge... The Targum is, "ye waters, that by the Word (of the Lord) hang above the heavens", in which is displayed the glory of amazing power, wisdom, and goodness. The most ancient Syrians and Arabians were thoroughly persuaded, that beyond the bounds of the visible heavens there was a great sea, without any limits; which some (Vid. Steeb. Coelum Sephirot. Heb. c. 7. s. 3. p. 126, 127. and Gregory's already mentioned Works…, p. 110) suppose to be the waters here meant"

Keil and Delitzsch state:

"Keerl, [makes] the bold assertion, that the mass of water which came through the windows of heaven at the flood was different from the rain which falls from the clouds, beyond the limits of the terrestrial atmosphere... this notion may also have things for its substance which lie beyond our [current] knowledge of nature. The Scriptures, from the first page to the last, acknowledge the existence of celestial waters, to which the rain-waters stand in the relation as it were of a finger-post pointing upwards (see Gen. 1:7).... for ever and ever (Psa. 111:8), i.e., in order for ever to maintain the position in the whole of creation which He has assigned to them"

Arthur Clarke explains this verse as

“Heavens exceeding heavens (heavens of heavens—the very highest). Systems of systems extending as far beyond the solar system, as it does beyond the lowest deeps… This refers to Gen 1:7, Clouds (Nebulae), vapours, air, exhalations, rain, snow, and meteors (Comets) of every kind.”

C. H. Spurgeon, declared regarding the Biblical Psalm that declares“Let the sea above roar, and the fullness thereof, at the presence of Jehovah, the God of Israel”:

“There is something of mystery about these supposed reservoirs of water; but let them be what they may, and as they may, they shall give glory to the Lord our God. Let the most unknown and perplexing phenomena take up their parts in the universal praise” ...for “Who layeth the beams of his chambers in the waters…” (Ps 104:3a), Spurgeon comments "His lofty halls are framed with the waters which are above the firmament. The upper rooms of God's great house, the secret stories far above our ken, the palatial chambers wherein he resides, are based upon the floods which form the upper ocean. To the unsubstantial he lends stability; he needs no joists and rafters, for his palace is sustained by his own power."

Albert Barnes adds

“The allusion here is to the waters which seem to be above… which seem to come from some higher region - some higher heaven”

The ISBE (International Standard Bible Encyclopedia) presents the next quotation under the word “Astronomy”, within its subsection III. “Physiography”:

"THE FIRMAMENT. (1) The Hebrew Conception. Above the, spherical earth was stretched out the “firmament” made on the second day of creation to “divide the waters from the waters” (Gen. 16). To the Hebrews the “firmament” was the apparent void above”, (2). And such, “firmament” “should be rendered “expanse” or “space”; it corresponds to the “empty space” of Job 26:7. The “expanse” was appointed to divide “the waters which were under the expanse, from the waters which were above the expanse”; and it has been argued from this that the upper waters must have been regarded as being enclosed in a watertight reservoir, furnished with sluices or floodgates, which could be opened"

Job 38:22 and 23

"Hast thou [Job] entered into the treasures of the snow? Or hast thou seen the treasures of the hail, Which I have reserved against the time of trouble, against the day of battle and war?"

Doctor Victor Paul Wierwille exclaimed when he quoted this verse:

"God spoke to Job... Are there treasures in snow and hail? The twenty-third verse is still future. Scientists came up a few years ago with a bold declaration that there are "floating ice cubes" weighing two and three hundred pounds each floating in space. I do not know if they are right or wrong, but my Bible says that there are going to be great hail stones [My comment: huge comets?], "...the treasures of the hail, which I have reserved against the time of trouble...." We simply thrill with the revelation of those men many, many thousands of years ago."

Some of those Scholar References:

1- Albert Barnes' Notes on the Bible (found inside e-Sword).

2- Adam Clarke's Commentary on the Bible. Adam Clarke's 1810/1825 commentary and critical notes on the Bible (found inside both e-Sword and The Sword Project).

3- John Gill's Exposition of the Entire Bible (found in e-Sword).

4- International Standard Bible Encyclopedia (ISBE), James Orr, M.A., D.D. General Editor; John L. Nuelsen, D.D., LL.D. Edgar Y. Mullins, D.D., LL.D. Assistant Editors; Morris O. Evans, D.D., PhD. Managing Editor; Melvin Grove Kyle, D.D., JJ.D. Revising Editor, 1844-1913 ed (found in e-Sword).

5- Keil & Delitzsch Commentary on the Old Testament (found in e-Sword).

6- The Treasury of David, by C. H. Spurgeon (found in e-Sword).

7- e-Sword, by Rick Meyers, URL: http://www.e-sword.net

8- Dr. V.P. Wierwille. God's Magnified Word. Volume IV, Studies in Abundant Living. 3rd Printing, 1980. Page 62. [Ref. found here]

Note:
Dear reader, please, never dismiss useful references, specially the older ones, most specially the Historical references found in the Bible!

Sobre el Agua en Marte y en la Luna [my early institutional publications (in CIATEJ) on the topic, in Spanish]

Kiwa hirsuta, New Animal Resembling Furry Lobster Found

2006-03-08T12:58:00.000-08:00

PARIS - A team of American-led divers has discovered a new crustacean in the South Pacific that resembles a lobster and is covered with what looks like silky, blond fur (the animal's pincers are covered with sinuous, hair-like strands)... The divers found the animal in waters 7,540 feet deep at a site 900 miles south of Easter Island last year... The new crustacean is described in The Journal of the National Museum of Natural History in Paris.

The animal is white and just shy of 6 inches long — about the size of a salad plate.

It is also blind. The researchers found it had only "the vestige of a membrane" in place of eyes, Segonzac said.

Ciencia-Alternativa

2006-03-02T06:30:00.000-08:00

http://www.oiacdi.org

Index 3 for Research on Intelligent Design

2006-02-28T08:14:00.000-08:00

Eulogy to Henry Morris, his contribution to the study of Biological Variation

2006-02-28T07:31:00.000-08:00

Henry Madison Morris (1918-2006)

With others, I also join my recognition to Henry Morris, specially in relation to his contribution to the study of Biological Variation.

Creationism’s Henry M. Morris, dead at 87; upheld Genesis flood. Feb 27, 2006, by Art Toalston. Baptist Press.

Dr. William A. Dembski wrote in memoriam:

>It’s with sadness I announce that Henry Morris died Saturday evening (2.25.06). Henry Morris was a great man, and all critics of Darwinian evolution are in his debt for maintaining pressure on this pseudoscience when so much of the Western world capitulated to it. As I wrote last year at this time (go here) in reference to a conversation with Michael Ruse about Henry Morris’s significance:

During our conversation, Ruse commented that for all his disagreements with the young earth creationists, and Henry Morris in particular, he did give them credit for, as he put it, “keeping this issue alive.” The “issue” here was the debate over biological evolution and, in particular, the possibility of design providing a viable alternative to existing materialistic accounts of evolution.

My own experience has abundantly confirmed Ruse’s remark. In traveling outside the United States, I’ve found that evolutionary theory goes largely unchallenged. In the United States, by contrast, there remains widespread skepticism toward evolution. And even though intelligent design has emerged as the most visible banner under which evolution is now being challenged, the challenge would not exist without the efforts of Henry Morris and young earth creationists.

I myself would not be a design theorist today without them. To be sure, I am not a young earth creationist nor do I support their efforts to harmonize science with a particular interpretation of Genesis. Nonetheless, it was their literature that first got me thinking about how improbable it is to generate biological complexity and how this problem might be approached scientifically.

>May the work of dismantling Darwinian materialism that Morris began come to completion soon.

To Dr. Dembski's remarks, Salvador Cordova responded:

I’d like to also pay tribute to Henry Morris for bravely keeping the issues alive. He was a fine professor of engineering at a very fine secular school of engineering, Virginia Tech.

He was a gentleman of most excellent character and courage. He fought the good fight against seemingly impossible odds. And today, in the most technlogcially advanced culture in history, over half the nation accepts that the universe and life were the products of intelligent design. Thank you Henry Morris.

While Jacktone wrote:

Yes, I thank God for Henry Morris. What a voice against false dogma. The church was catatonic in the face of so-called “science” until “The Genesis Flood”. Now the whole country is pondering the validity of Darwinism. Well done, Dr. Morris.

Now, let the man speak for himself! From his writings on Impact, we have selected the next ones:

The Vanishing Case for Evolution, by Henry Morris, Ph.D. [(Impact #156)]

Evolution - A House Divided (#194), by Henry Morris, Ph.D.

The Microwave of Evolution (#152), by Henry Morris, Ph.D.

Evolutionists and the Moth Myth (#176), by Henry Morris, Ph.D.

Let these works resound 'till the ends of the earth!

The Evolutionist Racketeering: Compatible Ancestry sold as Common Descent

2006-02-10T15:36:00.000-08:00

Buyer Beware (caveat emptor)!

Evolution is selling the Compatible Ancestry between organisms as a fraudulent and Incompatible “Common Descent”.

This work is a continuation of “Calling Darwin’s Bluff” and of “The Fraud of Evolution: Variation sold as Speciation.”

To have all the human diversity living today, an initial human couple was sufficient, that’s compatible ancestry within self-perpetuating groups. The same can be said for all the varieties of finches, and for all the varieties of cichlids, dolphins, gulls, crayfishes, dogs (included the wild dogs: wolves, coyotes, jackals and dingoes), cavefishes, elephants, Gasterosteus, Laupala crickets (second post on them), Calidris, Rhagoletis, etc., etc.

However, evolution is fraudulently using such examples above mentioned as their evidence that new species are being originated all the time (speciation), when in reality what they are describing is just variation within compatible groups of organisms. Microchange is being oversold by evolution as a speculative macrochange. Microevolution is being presented as a “prove” for a speculative an non-existent macroevolution.

According to evolution, a lizard and a bird were originated by one or by a couple, of by what? Or by a non-existent common ancestor that looked like what (like that fraudulent bird sold by National Geographic with the “expert help” of German Dr. Hans Dieter Sues)? Or by a single and non-existent haploid dinosaur? Or rather, dinosaurs, lizards and birds were originated by a monstrous couple of what? Or a couple was not needed at all? Or all of them were originated by a non-existent “reptobirdopo”? And what about the never existent “protomonohomo”? Or all living beings were originated by random processes within speculated primordial soups of self digesting aminoacids? No? Rather then, of nucleic acids? Like in a self destroying RNA world? No? Instead, of greasy lipids? Lipids that by themselves are useful for nothing? Or "the low carb world" (smile)? And that is the undeniable evidence that evolution has? And I have not been able even to mention the findings of Jonathan Wells, as described in his last 'musical satire of evolution' hit "overwhelming evidence", by The Mutations (Tammy Heath, Cynthia Ziesman and Terry Thoelke)! (smile.)

If you enter evolution, as Darwin and his current pals see it, you are welcome to their worlds of nothingness, to their worlds of speculations, of absurd claims, of errors, of frauds and of a rampant intellectual racketeering!

The current definition for a false "common descent" is:

Common descent (From Wikipedia, the free encyclopedia):

"A group of organisms is said to have common descent if they have a common ancestor. In biology, the theory of universal common descent proposes that all organisms on Earth are descended from a common ancestor or ancestral gene pool. A theory of universal common descent based on evolutionary principles was proposed by Charles Darwin in his book The Origin of Species (1859), and later in The Descent of Man (1871). This theory is now generally accepted by biologists, and the last universal common ancestor (LUCA or LUA). In 1859, Charles Darwin's The Origin of Species was published. The views about common descent expressed therein vary between suggesting that there was a single "first creature" to allowing that there may have been more than one..."

Has this definition changed since Darwin wrote his book? No, not really.

Let’s now see the definition of “Common Descent” starting with the chief deceiver:

Darwin wrote that, according to him,

“how many facts indicated the common descent of species” [In" F. Darwin & A.C. Seward, eds, More letters of Charles Darwin. 2 vols., London, John Murray, 1903. [page 367] Letter 278. To Otto Zacharias. 1877. Vol. 1. Ch 5.]

However, the contrary comment related to this preposterous statement of Darwin (today repeated as "fact" and ad nauseam by his materialistic followers) was done by Thomas H. Huxley (appeared as a footnote in the same reference as the above quotation, with my emphasis in bold and brackets):

"The facts to which reference is here made were, without doubt, eminently fitted to attract the attention of a [materialistic] philosophical thinker; but until the relations of the existing with the extinct species and of the species of the different geographical areas, with one another were determined with some exactness, they afforded but an unsafe foundation for speculation" [From Darwiniana, Essays by Thomas H. Huxley, London, 1893; pages 274-5.]

Darwin’s “Facts”, even according to his “bulldog” Thomas H. Huxley are “an unsafe foundation for speculation”! and are useful only “to attract the attention of a [materialistic] philosophical thinker”, and what kind of a materialistic “philosophical thinker”? "Thinkers" like Richard Dawkins, those “fulfilled atheists”, and the others that are agnostics, superficial, vain, vainglorious, "agnolites", etc…

Then, Darwin followed his rhetorical game of self-deception when he wrote [In: Francis Darwin ed., The foundations of the Origin of Species: Two essays written in 1842 and 1844 by Charles Darwin. Cambridge, 1909. [from Darwin’s 1844 Essay]:

“…we are not justified in prima facie rejecting a theory of the common descent of allied organisms from the difficulty of imagining the transitional stages… This want [LACK] of evidence of the past existence of almost infinitely numerous intermediate forms, is, I conceive, much the weightiest difficulty on the theory of common descent; but I must think that this is due to ignorance necessarily resulting from the imperfection of all geological records... the frequent and almost general presence of organs and parts, called by naturalists abortive or rudimentary… were shown to be simply explicable on our theory of common descent.”

My comment is that the lack of fossil record still the same as when Darwin wrote simply because there are no "transitionals", while the lack of eyes in the cavefish is adaptation! That’s the shutting down of unnecessary organs within a very specific environment! That has nothing to do with those Darwinian speculations!And Darwin again:

"Why do we wish to reject the theory of common descent? Before concluding it will be well to show, although this has incidentally appeared, how far the theory of common descent can legitimately be extended*... No doubt the more remote two species are from each other, the weaker the arguments become in favour of their common descent"

The footnote written by Darwin's son is the next: * This corresponds to a paragraph in the Origin, Ed. I. p. 483, vi. p. 662, where it is assumed that animals have descended "from at most only four or five progenitors, and plants from an equal or lesser number." In the Origin, however, the author goes on, Ed. I. p. 484, vi. p. 663: "Analogy would lead me one step further, namely, to the belief that all animals and plants have descended from some one prototype"

The fact is that in his full draft or "essay" of 1844 for his book the Origin, Darwin used the words "common descent" at least eleven times, while in the final version of his book he used that words not even one time! [Also, those words doesn't appear in his human 'evolution' speculations in "Descent of Man"]

Talk about Charles Darwin's rhetorics (link to a RealPlayer Video), self-contradictions and hypocrisy!

Another example of that, can be seen by the way Darwin wrote the end of the first edition of his Origins:

"probably all the organic beings which have ever lived on this earth have descended from some one primordial form, into which life was first breathed...
The whole history of the world, as at present known, although of a length quite incomprehensible by us, will hereafter be recognised as a mere fragment of time, compared with the ages which have elapsed since the first creature, the progenitor of innumerable extinct and living descendants, was created...
When I view all beings not as special creations, but as the lineal descendants of some few beings which lived long before the first bed of the Silurian system was deposited, they seem to me to become ennobled... There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one" [Darwin, On the origin of species. London, John Murray, 1859. Chap. XIV. Conclusion]

Who is the One that "first breathed" life? Who is the One that "created"? Who is the One that "originally breathed" life?

In the foundations of the Origin of species Part II we read that

:"In the 2nd edition "by the Creator" is introduced after "originally breathed."

The expression "originally breathed" was left in all his editions while the other ones: "first breathed", "was created", and "by the Creator" were removed in Darwin's later editions of Origins (all those terms were deemed by Darwin, "the Pentateuchal terms").

Dawin responded in the Athenaeum:

“Your reviewer [Dr. Carpenter]sneers with justice at my use of the 'Pentateuchal terms,' 'of one primordial form into which life was first breathed': in a purely scientific work I ought perhaps not to have used such terms; but they well serve to confess that our ignorance is as profound on the origin of life as on the origin of force or matter. Your reviewer [Dr. Carpenter] thinks that the weakness of my theory is demonstrated because existing Foraminifera are identical with those which lived at a very remote epoch” [Darwin, 'The Doctrine of Heterogeny and Modification of Species', Athenaeum. Journal of Literature, Science, and the Fine Arts, no. 1852, 25 April 1863, pp. 554-55.]

We can see here that even Darwin did not considered his book of Origin as a "purely scientific" one. So, the same hypocrisy of Darwin can be seen time after time by comparing his letters with his books. Next, in a fragment barely preserved, Darwin freely expresses himself with Hooker, his intimate friend; here, Darwin uses more "freedom of speech" by declaring, about the same Athenaeum 1863's incident:

"...Many thanks for Athenaeum, received this morning, and to be returned to-morrow morning. Who would have ever thought of the old stupid Athenaeum taking to Oken-like transcendental philosophy written in Owenian style!* ...It will be some time before we see "slime, protoplasm, etc.," generating a new animal.† But I have long regretted that I truckled to public opinion, and used the Pentateuchal term of creation,* by which I really meant "appeared" by some wholly unknown process. It is mere rubbish, thinking at present of the origin of life; one might as well think of the origin of matter. [C. Darwin to J.D. Hooker. March 29, 186.3 F. Darwin, ed., The Life and Letters of Charles Darwin. New York, D. Appleton & Co., 1905. Vol. 2. Ch. 4. p. 202]"

So, the evil Darwin left "the Pentateuchal terms" in his Origin because he "truckled to public opinion" and secretly he lived "regretting" having left that words in the Origin! Originally, what he really meant was expressed by himself: "I really meant "appeared" by some wholly unknown process..." So, leaving those Pentateuchal words in his Origin, for Darwin was "mere rubbish"! Also we can see that Darwin referred himself to the journal Athenaeum, to which he just wrote, as a "stupid" journal!

The notes of Darwin's son for this fragment are numerous and longer than the preserved paragraph itself!

One notable fragment from that notes is the next one, written by Darwin's critic, Dr. Carpenter: * (from the above quotation) - "...my conviction that the present state of scientific evidence, instead of sanctioning the idea that the descendants of the primitive type or types of Foraminifera can ever rise to any higher grade, justifies the anti-Darwinian influence, that however widely they diverge from each other and from their originals, they still remain Foraminifera."

For the rest of Darwin's notes for that revealing fragment, go to the original link, but, enough is here to say that in such notes we see a Darwin speculating about "the protein world", ancestor of the unfortunate speculation of "the amino acid world", predating the unfortunate and similar speculation of the "RNA world".

T. H. Huxley declares how Darwin's Origin helped him to left behind "the Pentateuchal cosmology":

"I was not brought into serious contact with the 'Species' question until after 1850. At that time, I had long done with the Pentateuchal cosmogony, which had been impressed upon my childish understanding as Divine truth, with all the authority of parents and instructors, and from which it had cost me many a struggle to get free" [F. Darwin, ed., The Life and Letters of Charles Darwin. New York, D. Appleton & Co., 1905. Chapter XIV. By Professor Huxley. On The Reception Of The 'Origin Of Species.']

Huxley already wanted to get rid of "the Pentateuchal cosmology" but was unable to do so, until he read Darwin's Origin! So, its effects are pernicious...

Years before, Darwin wrote to Hooker:

"You ask how far I go in attributing organisms to a common descent; I answer I know not; the way in which I intend treating the subject, is to show (as far as I can) the facts and arguments for and against the common descent of the species of the same genus; and then show how far the same arguments tell for or against forms, more and more widely different: and when we come to forms of different orders and classes, there remain only some such arguments as those which can perhaps be deduced from similar rudimentary structures, and very soon not an argument is left." [C. Darwin to J.D. Hooker. [18th. July, 1855]. F. Darwin, ed., The Life and Letters of Charles Darwin. New York, D. Appleton & Co., 1905. Vol. 1. Ch. 11. Page 425.]

Darwin knew that only the 'benevolence' of the materialistic people will do for him, as he also wrote, as we have seen it:

"No doubt the more remote two species are from each other, the weaker the arguments become in favour of their common descent" [Francis Darwin ed., The foundations of the Origin of Species: Two essays written in 1842 and 1844 by Charles Darwin. Cambridge, 1909. from Darwin’s 1844 Essay]

And also in his 1842 draft for the Origin Darwin wrote about the weakness of his speculating ideas:

"Who, seeing how plants vary in garden, what blind foolish man has done (#) in a few years, will deny an all-seeing being in thousands of years could effect (if the Creator chose to do so), either by his own direct foresight or by intermediate means,—which will represent (?) the creator of this universe. Seems usual means. Be it remembered I have nothing to say about life and mind and all forms descending from one common type (*). I speak of the variation of the existing great divisions of the organised kingdom, how far I would go, hereafter to be seen" [Darwin, 1842 essay on the origin of species. Part I] The notes that Darwin's son inserted here are # - See Origin, Ed. I. p. 83, vi. p. 102, where the word Creator is replaced by Nature [My comment: What about Dover? for Darwin it is O.K., but not for you, Dr. Dean Kenyon (for whom the editorial team allegedly replaced the word "Creation" with the word "Intelligent Design" for his book "Of Pandas and People")]. * - Darwin's Note in the original. "Good place to introduce, saying reasons hereafter to be given, how far I extend theory, say to all mammalia- reasons growing weaker and weaker."

Are the reasons for a distant and incompatible common descent improved? Not a shred! Ony by the use of a materialistic philosophy and rhetorics willing people can be fooled in such a way...

But, to conclude with this review, done as a reminder of Darwin's past lies and to be able to recognize its present leftovers, we need to ask to ourselves, who was that evil Hooker with which Darwin was so confident, and viceversa, as to use words like "stupid", in refering himself to a magazine and such extreme sincerity as to express his real feelings, and their real and hidden agenda?

This is the historical finding, from the UK, by Andrew Rowell:

Chuckling behind their hands....
I [A. Rowell] found this very revealing quotation in David Samuel’s book “Without Excuse.” It was from a Letter of J.D. Hooker to Charles Darwin following Hooker’s address at a meeting of the British Association in 1866. In that address he had declared that he saw evidence for design in variation itself:

“By a wise ordinance it is ruled, that amongst living beings like shall never produce its exact like…. A wise ordinance it is, that ensures the succession of being, not by multiplying absolutely identical forms, but by varying these.”

He [the Hooker] soon afterwards wrote to Darwin to assure him he was only talking like this to make the religious freaks feel comfortable with evolution!

He writes to Darwin:

"The only thing I do not like…. Was the passage about a wise Providence ordering &c, &c or something of that sort (I forget the words, it matters little). It is bosh and unscientific, but I could not resist the opportunity of turning the tables of Providence over those who will have a Providence in the affair, that yours is the God one and theirs the Devil’s." (Life and Letters of J.D. Hooker Vol 2 p. 106)

[A. Rowell concludes:] The clergy who suck up to Darwinists and say that there is no conflict at all between theism and atheism are rather like those who clapped Hooker’s address while he was chuckling behind his hand to his friend Charles.

The Hooker and The Darwin, Chuckling behind their dirty hands (smile.)

So, I conclude as I started, Buyer Beware (caveat emptor), Darwin's Evolution is a Big Fat Lie!

To the critics: You can classify this piece within the category of "history of the evolution deception".

http://teleological.org/?p=126

Today's News, 17 Pictures From Indonesia's New Organisms

2006-02-07T17:42:00.000-08:00

Humans Were Living Here Before the Neanderthals

2006-02-07T11:48:00.000-08:00

We already reviewed the finding that the DNA Shows that Neandertals Were Not Our Ancestors, also, confirming it, a newer (2004) Study Shows Neanderthals Were Not Our Ancestors, as Katerina Harvati et al demonstrated that:

examining the skulls of modern humans and Neanderthals as well as 11 existing species of non-human primates found strong evidence that Neanderthals differ so greatly from Homo sapiens as to constitute a different species... The study found that the differences measured between modern humans and Neanderthals were significantly greater than those found between subspecies or populations of the other species studied. The data also showed that the difference between Neanderthals and modern humans was as great or greater than that found between closely related primate species.

Harvati K, Frost SR, McNulty KP. Neanderthal taxonomy reconsidered: implications of 3D primate models of intra- and interspecific differences. Proc Natl Acad Sci U S A. 2004 Feb 3;101(5):1147-52.
Today we are going to see that Humans existed even before the Neanderthals:
Herto's Human Skull, photo by David L. Brill.

"...these new [Homo sapiens] fossils predate classic Neanderthals and lack their derived features."
White TD, Asfaw B, DeGusta D, Gilbert H, Richards GD, Suwa G, Howell FC. Pleistocene Homo sapiens from Middle Awash, Ethiopia. Nature. 2003 Jun 12;423(6941):742-7.

"The archaeological assemblages contain elements of both [late] Acheulean and Middle Stone Age technocomplexes. Associated faunal remains indicate repeated, systematic butchery of hippopotamus [and bovine] carcasses. Contemporary adult and juvenile Homo sapiens fossil crania manifest bone modifications indicative of deliberate mortuary practices."
Clark JD, Beyene Y, WoldeGabriel G, Hart WK, Renne PR, Gilbert H, Defleur A, Suwa G, Katoh S, Ludwig KR, Boisserie JR, Asfaw B, White TD. Stratigraphic, chronological and behavioural contexts of Pleistocene Homo sapiens from Middle Awash, Ethiopia. Nature. 2003 Jun 12;423(6941):747-52.

Commenting on these two articles we found the next two ones (supportive and semi-supportive, respectively):

Stringer C. Nature. 2003 Jun 12;423(6941):692-3, 695 (PDF). Human evolution: Out of Ethiopia.

"...possible early H. sapiens fossils... are scattered across Africa at sites such as Florisbad (South Africa), Ngaloba (Tanzania), Eliye Springs and Guomde (Kenya), Omo Kibish (Ethiopia), Singa (Sudan) and Jebel Irhoud (Morocco). But the best dated of these finds, from Florisbad and Singa, are problematic because of incompleteness and, in the latter case, evidence of disease..."

"...the most securely dated and complete early fossils that unequivocally share an anatomical pattern with today’s H. sapiens are actually from Israel, rather than Africa. These are the partial skeletons from Skhul and Qafzeh..."

"The [more recently found (2003) Herto] fossils are complete enough to show a suite of modern human characters... Three individuals are represented by separate fossils: a nearly complete adult cranium (skull parts excluding the lower jaw), a less complete juvenile cranium, and some robust cranial fragments from another adult... there seems to be enough morphological evidence to regard the Herto material as the oldest definite record of what we currently think of as modern H. sapiens."

Stringer is in the Human Origins Group at The Natural History Museum, London.

Faupl P, Richter W, Urbanek C. Nature. 2003 Dec 11;426(6967):621-2; discussion 622 (PDF). Geochronology: dating of the Herto hominin fossils.

"the estimated maximum age () is valid... the maximum age () can reliably be used for this important anthropological material."

Faupl is in the Department of Geological Sciences, University of Vienna.
Response to Faupl by the original authors Tim D. White et al

:"...the Upper Herto archaeological and palaeontological remains, including the newly identified Homo sapiens idaltu, are securely constrained..."

Tim D. White in full conversation.

A popular comment related to the same finding of Herto:

"Three fossilized skulls discovered near the Ethiopian village of Herto in 1997 have now been identified as the oldest known remains of modern humans... modern humans existed thousands of years before the Neanderthals"

Then, a conversation with Tim D. White (notice that part 4 is entitled: "Discovery of the Earliest Human").

The Adaptations of the Cave Fish

2006-02-03T12:09:00.000-08:00

Adaptive Comparisons of Cave Animals

Found at: http://www.reocities.com/kubyimm3/adap.jpg [thanks for saving the images!]
In a food-rich Mexican cave, just a few sweeps of the net yield as many as thirty finger sized Mexican blindfish. Indeed, these fish are so plentiful in certain caves that a hundred or more may be visible in just a few cubic yards of water. These closely related Mexican cave fish and a widespread surface form are so similar that some scientists think all may be subspecies of the same animal. In any case, the fish can interbreed, and residents of some caves show all degrees of eye and pigment degeneration. Here, a blind Mexican cave fish and its surface relative are compared.

Gliding slowly through the water, the blind cave fish Typhlichthys pauses occasionally to nose under rock ledges in search of isopods and other food. Vibration receptors on its head and sides detect movements in the water and guide it to its prey.

Typhlichthys subterraneus (Southern Cavefish).

The Cave Adaptations of a Fish. Now, imagine similar transformations for a mammal being adapted from the surface to the underworld...

References:
Mohr, Charles E. & Poulson, Thomas L., 1966, Our living world of nature: “The Life of the Cave”, McGraw-Hill, the World Book Encyclopedia and the U. S. Department of the Interior, 232 p., New York.

This continues my postings on Adaptive Comparisons of Cave Animals.

Note: At the end of the essay "The Simple and the Primitive: Some Cautionary Tales" (Dec. 2004), its writer declared:

"intelligent design, in striving to produce a historical narrative of life, is not going to be cut down by people raising philosophical objections."
Other cave-dwellers:
http://fdocc.blogspot.com/2006/01/new-27-cave-bugs.html
http://fdocc.blogspot.com/2006/02/cave-dwellers-known-since-1966.html
http://fdocc.blogspot.com/2006/02/more-adaptive-comparisons-of-cave.html
http://fdocc.blogspot.com/2006/01/laupala-cricket-variation.html

More Adaptive Comparisons of Cave Animals

2006-02-03T11:46:00.000-08:00

Ozark Fish

Axolotl

To pursue our study on adaptive comparisons of cave animals, started with 27 bugs discovered recently and continued with organisms known since 1966, we will see now some salamanders living inside the caves:

Found at: http://www.geocities.ws/kubyimm3/axol.gif [Thank you for saving it!]

Left: Several highly adapted species of cave salamanders found in Texas probably looked somewhat like this common surface dweller before they entered caves. Like its cave-dweling relatives, this salamander retains feathery gills and other larval characteristics even as an adult. Right: Two Texas salamanders, each inhabiting separate cave systems, probably resemble past stages of the highly adapted Eurycea rathbuni. Compared with their surface relative, they show progressively greater loss of pigment, degeneration of eyes, elongation of legs, slimming of the body, and flattening of the snout. Possibly at some time in the future both species also will develop the grotesque modifications of Eurycea rathbuni.
Eurycea rathbuni (Stejneger, 1896) Texas Blind Salamander.

With some similarities to Eurycea rathbuni, Typhlomolge rathbuni, the famous Texas blind salamander, which inhabits the San Marcos Pool of the Edwards Aquifer. This was the first organisms listed as endangered in the USA in 1967.
And similar to the second one: Eurycea, a troglobitic salamander from the Buttercup Creek Karst, near Austin, Texas.

Found at: http://www.geocities.ws/kubyimm3/ozark.gif [Thanks for saving it!]

Left: Slender and ghostly pale, the fully transformed adult Ozark blind salamander is three to four inches long. Its gills have disappeared, and its eyelids have grown together over small, nonfunctional eyes. The adult salamander moves freely in and out of water and usually lives deeper in caves that the larval form (right), which is from two to three-inch-long, and lives in cave streams and pools but sometimes ventures aboveground, unlike the adult, it has eyes, conspicuous coloration, and plumelike gills. Right: As the larval Ozark blind salamander approaches metamorphosis, it gradually loses pigmentation, its gills begin to regress, and its eyes become smaller in proportion to its head. Already losing the use of its eyes, the maturing larva begins to depend more on vibrations sensed through its lateral line system in order to locate isopods (in the picture), flatworms, and other small prey.

Head of G. palleucus, the Tennessee cave salamander. There are three subspecies.

References:
Mohr, Charles E. & Poulson, Thomas L., 1966, Our living world of nature: “The Life of the Cave”, McGraw-Hill, the World Book Encyclopedia and the U. S. Department of the Interior, 232 p., New York.

Alphabetical List of Cave Life.

Other cave-dwellers:

http://fdocc.blogspot.com/2006/02/adaptations-of-cave-fish.html

http://fdocc.blogspot.com/2006/01/new-27-cave-bugs.html

http://fdocc.blogspot.com/2006/01/laupala-cricket-variation.html

http://fdocc.blogspot.com/2006/02/cave-dwellers-known-since-1966.html

Cave-Dwellers Known Since 1966

2006-02-03T11:26:00.000-08:00

In a previous post I declared: "how many of them [cave bugs] are just compatible VARIETIES of their related counterparts that we already know over the surface?"

Next, we will be able to see and to compare more cave dwellers known at least since 1966:

Left: This inch-long troglobitic isopod is a marine relict inhabiting Mexican caves along a former seacoast. Its possible ancestors were ocean-dwellings which invaded fresh-water caves when the ancient coastline retreated. Right: A predatory white spider prowls through the dark interior of a cavern on the Edwards Plateau. Troglobitic spiders usually stalk their prey instead of engaging in the energy-consuming practice of spinning webs.

Left: Blind but mysteriously sensitive to light, a cave-dwelling millipede curls helplessly in the glare of a flashlight beam. As it becomes more fully adapted to life in the cave over the years, it may lose even this feeble response to the intrusion of light into its nighttime world.

Two closely related Texas amphipods, a blind white cave dweller (left) and an eyed surface dweller (right), are each about a quarter of an inch long. Floods carry surface amphipods over wide areas, but cave amphipods tend to be restricted to single cave systems.

This two fresh-water shrimp illustrate a common adaptation of cave animals. The cave species (left) lays only a few large-yolked eggs at a time. Thus the young cave shrimp will be relatively well developed when they have to find food for themselves. The surface species (right) lays many small eggs. Once deposited, the incubating eggs are attached beneath the mother´s body.

Left: The large compound eye of a surface crayfish glints with hundreds of minute lenses. Right: The troglobitic (cave) crayfish has no eyes, only a knoblike supporting stalk. It retains eyestalks since the structures contain several organs not related to vision.

A pale shadow of its surface-dwelling relative, the blind and colorless cave crayfish (left) seems in every way more delicate than its larger surface relative (right). The cave species is slower-moving and able to fast between infrequent meals. It has a slimmer body, more slender legs, and longer antennae than the dark, robust surface dweller.

See also the compatible heterosis on The Crayfish Variation.

Reference:
Mohr, Charles E. & Poulson, Thomas L., 1966, Our living world of nature: “The Life of the Cave”, McGraw-Hill, the World Book Encyclopedia and the U. S. Department of the Interior, 232 p., New York.

And other cave-dwellers:

http://fdocc.blogspot.com/2006/02/adaptations-of-cave-fish.html

http://fdocc.blogspot.com/2006/01/new-27-cave-bugs.html

http://fdocc.blogspot.com/2006/01/laupala-cricket-variation.html

http://fdocc.blogspot.com/2006/02/more-adaptive-comparisons-of-cave.html

More Images for The Discovery of New Organisms

2006-02-02T08:52:00.000-08:00

Taken from: http://news.bbc.co.uk/olmedia/380000/images/_382900_deer1..jpg

Leaf deer (leaf muntjac), discovered in a remote mountainous region of South East Asia. It stands just 50 cm (20 inches) at the shoulder, and weighs about 12 kg.

Taken from: http://news.bbc.co.uk/olmedia/655000/images/_659849_rat2.jpg

The new South-American rodent Cuscomys ashaninka, a powerfully-built animal, pale grey, with a white streak running along its head to its snout, with large claws (there were found additionally two new mice, two orchids, 11 butterflies and more than a dozen new frogs and lizards.)

Taken from: http://news.bbc.co.uk/olmedia/395000/images/_395381_rhino3.jpg

The Vietnamese rhinoceros, a sub-species of the Java rhino, known also as the lesser one-horned-rhino.

Between 50 and 60 animals of the other sub-species survive in Java itself, but cross-breeding between the two is thought to be impossible.

My comment: Those subspecies of rhinos indeed can interbreed!

Taken from: http://news.bbc.co.uk/olmedia/420000/images/_422674_rbt300.jpg

Striped rabbit revealed in Laos and Vietnam forest, resembling the endangered Sumatran striped rabbit (seen only once since 1916 and captured by a camera again in 1998), the only other known striped rabbit (in the last few years a forest pig and a hoofed animal like an antelope, the saola, have also been found in the same region... "If there are large mammals still in there, you can bet there are interesting invertebrates as well", Dr Bell said.)

Again, more compatible VARIETIES of their related counterparts that we already know!

Add this list and images to the previously presented Bioengineering and The Discovery of New Organisms and to The New 27 Cave Bugs.

The New 27 Cave Bugs

2006-01-27T11:51:00.000-08:00

Last Sunday, I read it in the newspaper. Today, we can see here 6 of those 27 bugs.

From: Sequoia National Park, California.
"spiders, centipedes, scorpion-like creatures and other animals have been discovered in the dark, damp caves beneath two national parks in the Sierra Nevada... included a relative of the pill bug so translucent that its internal organs are visible, particularly its long, bright yellow liver. There was also a daddy long legs with jaws bigger than its body, and a tiny fluorescent orange spider."

Taken from: http://www.ci.austin.tx.us/water/images/bone_cave_harvestman.jpg

A spider-like creature called a harvestman.

"Not only are these animals new to science, but they're adapted to very specific environments -- some of them, to a single room in one cave," said Joel Despain, a cave specialist who helped explore 30 of the 238 known caves in Sequoia and Kings Canyon National Parks."

"While it is extremely rare to find new mammal or bird species on the surface, caves still hold an abundance of secrets. Like the deep sea, they are often difficult to reach and seldom explored."

Next, a cave woodlouse, a millipede, a soldiers dipluran (eyeless silverfish) and a spider, respectively (from the same study):

Taken from: http://www.livescience.com/images/060118_millipede_02.jpg

Taken from: http://news.softpedia.com/images//news2/27-de-specii-noi-in-pesterile-din-Statele-Unite-2.jpg

However, y'all see at your own risk the ugly and fat "pseudo scorpion", from the same study (smile.)

Taken from: http://www.livescience.com/images/060118_soldiers_dipluran_02.jpg

Taken from: http://news.softpedia.com/images//news2/27-de-specii-noi-in-pesterile-din-Statele-Unite-3.jpg

The species have yet to be named, described scientifically... "We don't know how long they live, what kind of habitat they prefer..." Krejca said.

Well, of course not the beach! Not even sunny surfaces! Those critters obviously prefer the environments of the caves in which they were found! ... However, I wonder, how many of them are just compatible VARIETIES of their related counterparts that we already know over the surface?

Add this list and images to the previously presented Bioengineering and The Discovery of New Organisms.

Other link: Scientist highlights diversity of cave life, by Leon Alligood.

See other cave-dwellers at:

http://fdocc.blogspot.com/2006/02/adaptations-of-cave-fish.html

http://fdocc.blogspot.com/2006/01/laupala-cricket-variation.html

http://fdocc.blogspot.com/2006/02/cave-dwellers-known-since-1966.html

http://fdocc.blogspot.com/2006/02/more-adaptive-comparisons-of-cave.html

The Maggot (Rhagoletis Fly) Variation

2006-01-27T09:28:00.000-08:00

The Lonicera fly (Rhagoletis pomonella), a new natural variety, product of interbreeding between the blueberry maggot (Rhagoletis mendax) and the snowberry maggot (Rhagoletis zephyria.)

In the public discourse of this finding, or at least in the first abstract presentation on the subject, the use of the word 'speciation' was not even used at all by its authors:

The other hybrid bridge - Hybridization between specialist insects facilitates host shifts. 2004. Dietmar Schwarz, Bruce McPheron. [Tuesday, August 3, 8:00 AM to 11:30 AM. The Ecological Society of America (ESA), Portland, Or.]

However, almost a year later, evolution and its 'speciational' discourse and politics were evident, together with its fallacies and its non-sense, let's see (remember to replace the senseless word of 'speciation' with the more accurate word of variation (as well as to replace here 'species' with the accurate word variety) as we are dealing here with variation within compatible organisms):

Schwarz D, Matta BM, Shakir-Botteri NL, McPheron BA. Host shift to an invasive plant triggers rapid animal hybrid speciation. Nature. 2005 Jul 28;436(7050):546-9.

From Nature's the Abstract:

"An alternative speciation route is homoploid hybrid speciation (1) in which two ancestral taxa give rise to a third, derived, species by hybridization without a change in chromosome number.

Although theoretically possible it has been regarded as rare (1) and hence of little importance in animals.

On the basis of molecular and chromosomal evidence, hybridization is the best explanation for the origin of a handful of extant diploid bisexual animal taxa (2, 3, 4, 5, 6).

The frequency of homoploid hybrid speciation in animals may therefore be higher than previously assumed." [Note: The reference's numbers in the original]

Now, let's see how the evolutionarily biased media presented it:

New animal species evolved in an instant, Bob Holmes. NewScientist.com news service. 18:24 27 July 2005.

"A new species of insect may have arisen in an evolutionary eye-blink as a result of cross-species mating. The discovery suggests that hybridisation - well known to be an important force in producing new plant species - may also be widespread in animals."

"...The researchers are not yet willing to declare the honeysuckle maggot has completed this process [of a speculated and non-existent evolutionary 'speciation'], Schwarz says, because they have not ruled out the possibility of a low level of interbreeding with at least one of the parent species."

"If hybridisation often leads to shifts in host preference, it could be much more important in animal evolution than anyone had suspected, says Schwarz. After all, many - perhaps even most - animal species on Earth live in tight association with a particular host. "It makes one think it is possible for hybridisation to be important in generating biodiversity," says Thomas Dowling, an evolutionary biologist at Arizona State University in Tempe, US."

My comment: In January 15 2005 my paper on Intelligent Design to Generate Biodiversity was posted at ISCID. Directed hybridisation will indeed still be "important in generating biodiversity"

See how the 'evolution-avid' distorters of reality from National Geographic presented it:

Evolution Revolution: Two Species Become One, Study Says. By James Owen for National Geographic News. July 27, 2005.

In the picture for this article we read the next legend:

Rhagoletis pomonella (Photo: Guy Bush)

"The newly discovered Lonicera fly species arose through hybridization, a new study says. Two other fly species mated and formed a hybrid, a combined form that cannot mate with its fellow hybrids. Given a separate niche in which to evolve—in this case, an alien huneysuckle imported to the U.S. — a hybrid animal can become a full-fledged new species, according to researchers."

So, here the National Geographic bullies are affirming that the new variety of maggot is "a combined form that cannot mate with its fellow hybrids." However, we just read in the other "proevo-promo" that the original researchers "have not ruled out the possibility of a low level of interbreeding with at least one of the parent species."

So, in their 'little' ideological extreme, National Geographic is affirming an evolutionary fairy tale or fallacy not even subscribed by the scientists that did the study themselves!

Then, National Geographic declares that

"George Turner is a professor of evolutionary biology and biodiversity at the University of Hull in England. He agrees that animal evolution through hybridization may be much more widespread than previously believed."

Remember, here we are in reality dealing with variation within compatible animals. A new variety fully fertile and fully able to interbreed with the other varieties of the group.

Then, there we have National Geographic again declaring that:

"Hybrids that aren't sterile may have the opportunity to become a full-blown new species."

That we know must be corrected to better reflect reality as: >"Hybrids that aren't sterile may have the opportunity to become a full-blown new VARIETY."

Finally, Schwarz said. "In animals there has been so far only limited information on this mode of speciation."

In this mode of what? In this mode of VARIATION! You got it!

The first author of that paper declares:
Dietmar Schwarz. Postdoctoral Scholar, Entomology, PSU. Diplom Biology, Christian-Albrechts University Kiel, Germany. Ph.D. Entomology, Penn State.

"I study the natural hybridization of Rhagoletis mendax and Rhagoletis zephyria, which is associated with a host shift to introduced honeysuckle, Lonicera spp."

And he also declares

:"My research focuses on the evolutionary and ecological consequences of hybridization - especially its role in speciation - in host specific insects. The system that I am using is the Lonicera Fly, a newly discovered population within the Rhagoletis pomonella species group. The Lonicera Fly is an independent population that arose by hybridization between two native taxa, R. mendax and R. zephyria, and hybrid origin genotypes are only found on introduced species of the Lonicera tatarica complex. This system represents a unique example for a combination between hybridization and a recent host shift in a host specific animal."

In the personal statement of Dietmar Schwarz we have the evidence that his work is done in "a newly discovered population within the Rhagoletis pomonella," which is "an independent population that arose by hybridization between two native taxa, R. mendax and R. zephyria." This is variation within compatible organisms, plain in simple. This is not the evolutionary graal for "the origin of species", this is not the speculative 'speciation' at all, this is not "macroevolution" at all!

For academic purposes, let's conclude with the basic references presented by the author in his original thesis:

Natural Hybridization And Speciation In Rhagoletis (Diptera: Tephritidae) 2004 Dietmar Schwarz (Full PhD Thesis in PDF).

"During speciation by introgressive hybridization, hybrid offspring do not become immediately reproductively isolated, but can still interbreed with the parental taxa to some extent. This results in the formation of a “group of recombinant individuals” (Dowling, T. E., and C. L. Secor. 1997. The role of hybridization and introgression in the diversification of animals. Annual Review of Ecology and Systematics 28:593-619), which may evolve reproductive isolation from its parents. Well-documented examples for introgressive hybridization are rare both in animals and in plants (Dowling, T. E., and B. D. DeMarais. 1993. Evolutionary significance of introgressive hybridization in cyprinid fishes. Nature 362:444-446; Rieseberg, L. H. 1997. Hybrid origins of plant species. Annual Review of Ecology and Systematics 28:359-89). It is unclear whether speciation by introgressive hybridization is a mode of speciation that occurs only rarely in nature or whether it is just difficult to document (Dowling and Secor 1997). Unlike polyploidization, it does not leave a characteristic signature in the hybrid species’ genome.

The mechanisms by which animal hybrid swarms become reproductively and ecologically isolated are poorly understood. The literature contains only three examples
of speciation by introgressive hybridization in animals. They comprise three fish
(DeMarais, B. D., T. E. Dowling, M. E. Douglas, W. L. Minckley, and P. C. Marsh. 1992. Origin of Gila seminuda (Teleostei: Cyprinidae) through introgressive hybridization: Implications for evolution and conservation. Proceedings of the National Academy of Sciences of the USA 89:2747-2751; Salzburger, W., S. Baric, and C. Sturmbauer. 2002. Speciation via introgressive hybridization in East African cichlids? Molecular Ecology 11:619; Smith, P. F., A. Konings, and I. Kornfield. 2003. Hybrid origin of a cichlid population in Lake Malawi: implications for genetic variation and species diversity. Molecular Ecology 12:2497-2504) and one mammalian example (Wayne, R. K., and S. M. Jenks. 1991. Mitochondrial DNA analysis implying extensive hybridization of the endangered red wolf Canis rufus. Nature 351:565-568). These studies provide morphological and genetic evidence that make a hybrid origin the most likely explanation for the origin of an extant species, but do not report empirical data on potential mechanisms of speciation. In all four cases the authors explicitly or implicitly state that allopatric speciation is the most likely mechanism by which these animal hybrid taxa became isolated.

In plants, the work by Rieseberg and coworkers provides the best-documented example for speciation by introgressive hybridization (Rieseberg, L. H., C. Van Fossen, and A. M. Desrochers. 1995. Hybrid speciation accompanied by genomic reorganization in wild sunflowers. Nature 375:313-316; Rieseberg, L. H., B. Sinervo, C. R. Linder, M. C. Ungerer, and D. M. Arias. 1996. Role of gene interactions in hybrid speciation: evidence from ancient and experimental hybrids. Science 272:741-745). These authors showed that certain species of sunflowers formed by hybridization between two parent taxa with the same chromosome number. By experimental studies Rieseberg et al. (1995 and 1996) showed that, although the hybrid taxa had the same chromosome number as their parents, they were distinguished by chromosomal reorganizations from the parent taxa that serve as a reproductive barrier. Rieseberg (1997) uses the term “homoploid” to distinguish examples like the hybrid sunflowers from “polyploid” hybrid species. Dowling and Secor (1997) propose a parallel term for animal hybrids that originated by introgressive hybridization. They term such taxa “diploid, bisexual hybrid species.”

Which are “Diploid, bisexual hybrid VARIETIES!.” So, here we have seen that such examples, no matter how frequently are chanted as examples of 'speciation', are just examples of variation within compatible organisms, as is the case for the cichlids and as is the case for the red wolf, already seen.

So, my dear student, once again "Don't be fooled by the evolutionary establishment and by its deceiving press releases"!

The fingerprints of Shannon Melendi versus Colvin "Butch" Hinton III, her killer

2006-01-27T07:03:00.000-08:00

In its last show, "48 Hours Investigates" presented the case of a multiple criminal (Colvin "Butch" Hinton III) which may be freed in 14 years from now (No Way!). The handling of the evidence was extremely poor as not to preserve or detect any fingerprint of the criminal in the vehicle of the victim or in the evidence left at the place of the criminal's phone call. With an ID thinking I may suggest looking for the unexpected evidence, like the fingerprints of the victim (Shannon Melendi) in every possible location in which she may have been held as prisoner.

The Cichlid Variation

2006-01-26T11:03:00.000-08:00

Yesterday, I wrote in My last comments on the Laupala cricket variation: "Let's see which other organism the [‘Laupala diversity’] authors include in their attempt to justify their speculations":

"The highest speciation rate [among Laupala] is exceeded only by that of the rapidly speciating African cichlid fish... African cichlid fish exemplify this process,with sister species differing primarily in male coloration, a secondary sexual trait. From this pattern, it has been argued that the spectacular diversification in African cichlid fish is driven by sexual selection..."

"Is this really so? Is it really that cichlids are 'speciating' into different 'species'? NO!. The cichlid fishes are also able to interbreed producing fertile offspring, being just varieties as well (not so different to the human or the dog diversity.)"

Richard B, Hoppe responded at ISCID, to my Intelligent Design to Generate Biodiversity after I asked him why similar organisms interbreeding were being used as ‘examples’ of a non-existent 'speciation':

... Life is finite, and one expends one's time and effort according to some priorities. This particular question, being answerable (with some effort) by he who asked it, is not a top priority for me. I will note that a search on [cichlids speciation] on Google Scholar yields nearly 1,000 hits.”

To him I wrote in response: "Those Cichlids that you mentioned before are just "subspecies", not "new species" which is the presumed [and inflated, I must add] claim for evolutionary 'speciation', which is 'par' to a non-existent 'macroevolution'."

"Being the key and practical factor, the "FERTILE OFFSPRING".

In these cloudy areas, bright color morphs have disappeared and the fish have become similar and dull in appearance through hybridization (Seehausen et al. 1997).

So, cichlids produce viable and vigorous fertile hybrids according to the paper co-authored by the same Ole Seehausen:
Turner GF, Seehausen O, Knight ME, Allender CJ, Robinson RL. How many species of cichlid fishes are there in African lakes? Mol Ecol. 2001 Mar;10(3):793-806 (see its quotes below the picture).

Taken From: http://www.accuracyingenesis.com/cichlids.jpg

In this picture you can see that the 10 different cichlids here portrayed, are not only and erroneously considered as if being members of different 'species', but worst, as if being members of 'different' 'genus', and that without including the fertile interbreeders between Pundamilia x Platytaeniodus (also considered erroneusly as two different 'genus'), as mentioned in the next paragraph. So, here again, there is one true species with limitless varieties, with limitless sub-species.

Quotes from the reference given above the picture (taken from its PDF):

"many taxa... produce viable, fertile hybrids... We have produced intergeneric hybrids of Lake Victoria cichlids (Pundamilia x Platytaeniodus) that have not shown any evidence of loss of viability or fertility up to the 5th generation."

"The evidence is clear for everybody to see, but 'what the heck', RBH don’t have time to go on deeper on this, right? However RBH has more than enough and sufficient time not only to flood all the Internet but also to bash down the related works of Bryan Leonard (sorry but that's not fair)... And all this "in the name of Darwin" and supporting his evolutionary speculations at the macrolevel, right?"

So, RBH took a littke bit of time, just a little, then answering that:

Gee, sure looks like speciation to these folks, and also to these folks.

So, I thanked him for the examples, and then I wrote:

"Again, I don't want to be contentious with you, I just want to study and to leave the evidence for everybody to see."

"The fact of the articles that RBH is linking here is 'subspeciation' or the origin of new varieties, never the origin of 'new species'; for example, from the first link that you present:

"... mbuna will hybridize ... (McElroy, D. M. & Kornfield, I. (1993) Copeia 1993, 933-945)... We cannot rule out a role for hybridization..." [Phylogeny of a rapidly evolving clade: The cichlid fishes of Lake Malawi, East Africa. R. C. Albertson, J. A. Markert, P. D. Danley, and T. D. Kocherdagger PNAS Vol. 96, Issue 9, 5107-5110, April 27, 1999]

"That's precisely the key of my studies to demonstrate that there is genetic compatibility, that the offspring produced is fertile, which will help us in the engineering of new varieties. Again, those cichlids are not different 'species' but different varieties within the same organism."

"And from RBH's second link:

"We first estimated the effective number of genetic factors controlling differences in the cichlid head through a comprehensive morphological assessment of two Lake Malawi cichlid species and their F1 and F2 hybrid progeny."

"If those two morphologically different cichlids are producing F1 and F2 generations, that means that their offspring is fertile, which again indicates their genetic compatibility. Those again, are just varieties within the same organism."

Even if today thousands of varieties of organisms are systematically misclassified as if being of different 'species', or even different 'genus' (like the above example with fertile cichlids produced by Pundamilia x Platytaeniodus in Africa) the future recognition of their reproductive compatibility will resolve such deliberate blindness promoted today by that rampant Darwinism in biological sciences.

To see more cichlid pictures, click here.

Concluding, again: Those Cichlids are "subspecies" but not "new species", which is the false and presumed claim of an evolutionary bankrupt 'speciation' = 'macroevolution'.

My last comments on the Laupala cricket variation

2006-01-25T09:23:00.000-08:00

Earlier I presented here and at ARN an UPDATE on the Laupala cricket variation. However, at ARN and for a second time Myrmecos (http://alexanderwild.com/) was trying to derail the topic that he himself started. Here, I am going to write my last comments on that issue:

More excerpts of the 2006 article on Laupala demonstrating the resulting fertile offspring or F2:

Matings between L. paranigra and L. kohalensis result in viable and fertile offspring, and the second generation of hybrids (F2) provide a genetic and phenotypic mosaic of parental types

And the comment of the director of the Laupala studies:

"acoustic variants can interbreed and hybridize" [Kerry L. Shaw (broken)]

Then we read in the supplementary material (in DOC) from their Nature article:

"Due to a lack of resolution, the species L. hapapa, L. oahuensis, and L. pacifica were considered a single species..."

That statmenet, together with the one we quoted before [from their 2006 paper(broken)]:

“In close-range encounters, aspects of chemical signaling may be important to mate recognition within species and may further reduce the probability of interbreeding among divergent lineages. The nature and strength of this barrier is yet unknown.”

That's the real deal, compatible organisms producing compatible varieties or well defined lineages within their compatible group!

Let's see which other organism the authors include in their attempt to justify their speculations (Myrmecos, it is not 'the fruit flies', which are the ones that you are trying to sneak in the Laupala topic), my comments in brackets '[ ]':

"The highest speciation rate [among Laupala]is exceeded only by that of the rapidly speciating African cichlid fish... African cichlid fish exemplify this process,with sister species differing primarily in male coloration, a secondary sexual trait. From this pattern, it has been argued that the spectacular diversification in African cichlid fish is driven by sexual selection..."

The cichlid fishes are also able to interbreed producing fertile offspring, being just varieties as well (not so different than the human or the dog diversity.) Previously, they wrote that:

"[Laupala] Females prefer pulse rates of their own species, so divergence in male song reduces the chances of interbreeding between species..."

Then, in a separate paragraph they wrote confirming again the speculative nature of their original paper (clucked by Myrmecos at ARN, and clucked also by Nature and by Science, so, don't worry Myrmecos, you are in 'good' evolutionary company):]

"Whether sexual selection has promoted the diversification in song in Laupala remains to be proved [which happened to be wrong according to their most recent study on the 'nearby' L. paranigra and L. kohalensis linked above]"

L. paranigra and L. kohalensis are just two different varieties of cricket, not two different 'species.'

Yesterday, I wrote at ARN to Myrmecos,

You diverted again the topic!

Next is the absurd graphic that we are talking about here, in this post that you yourself started [with such an erroneous title that even Leonard didn't liked it (smile)]:

Here, in red rectangles I have emphasized the three VARIETIES of crickets mentioned by the authors as if being members of distant and different 'species'. First, excerpts from that original and speculatively wrong article published by Nature:

1.

"... speciation on the actively growing and youngest island, Hawaii, seems to be in progress, as diversity in L. cerasina was probably masked by sampling a single population per species. Populations of L. cerasina are acoustically diverse, and more intensive analysis using AFLPs reveals several distinct genetic groups that correspond to acoustic and geographical variations. We conclude that speciation on Hawaii Island is both explosive and ongoing."

My comment: Here they are talking of variation WITHIN Laupala cerasina!!! So, we must correct their inflated claims by declaring that "We conclude that COMPATIBLE VARIATION on Hawaii Island is both explosive and ongoing" [!!!]

2.
Then we read the next:

"L. cerasina and L. kohalensis are, in comparison [to corals], more distantly related. They are hypothesized to be members of different major lineages of Laupala, perhaps diverging as many as 5 million years ago..."

My comment was that 'speciationists' can speculate ('calculating speculations') their multiple and useless times of ‘divergence’ [as in such and completely useless graphic that I criticize here, of which even Science found useful only as an ideological "promo" of its wrongly-focused and biased article on "evo'nactio" (smile), already linked before, with its rebuke], just to find out that such organisms are indeed compatible and producing a vigorous and fertile offspring!

Then, the third and most recent quote:

3.

"...the hypothesis that the premating barrier between L. paranigra and L. kohalensis is maintained by the female’s preference for a conspecific male’s song at close range was not supported by the present study."

My comment: After the failure to demonstrate that the male's song is a factor of 'speciation' (which when properly considered is just variation within compatible organisms), the authors wrote in their most recent paper (already quoted) that it may be rather the animal chemistry what make them choose 'their likes' rather than 'their less-likes'.

Replace this absurd graphic with one portraying the human variation and you will see the absurdity within the complete field of 'speciation' and, by 'natural linkage', you will be able to see the complete absurdity within the biased 'evolutionary' realm, kingdom, dominion or establishment (anything you may want to call it, with the EXCEPTION of calling it 'sound science'.)

And related to what Gould wrote (posted by Leonard), the modern failure to justify any 'speciational' event beyond the realm of compatible organisms may render as well Gould's quote, to better reflect reality (something impossible within the current and 'totalitarian naturalistic' dominion of Darwin's views, in disregard of whatever 'new 'naturalistically' driven labels' may emerge...).

So, insted of what Gould wrote:

"Without geographic isolation, favorable variants will not accumulate in local populations, for breeding with parental forms is a remarkably efficient way to blur and dilute any change that might otherwise become substantial enough to constitute a new species."

Please, replace that end with the next statement and you will have a most accurate picture that even flows more 'naturally' (smile) with Gould's statement on "favorable variants": "...any change that might otherwise become substantial enough to constitute a new VARIETY"

The complete evolutionary field of speciation is biased by the pretense of attempting to justify Darwin’s “origin of species”. Those crickets and the other organisms studied by ‘speciationists’ (finches, cichlids, threespine fishes, etc…) are not diverging ‘species’, but just genetically compatible varieties.

So, the fraud of 'speciation' is its overselling (of such natural variation) as a macroevolutionary ‘proof’, when indeed it is just microevolution in action; hence, compatible variation.

Myrmecos, you haven’t answered to my 01/28/05 question (see above):

If you were a journal editor or a grant provider, are you willing to finance/publish a research paper based only on Intelligent Design premises…?

Evidently, your answer must be a flat NO. However, frequently you are asking for the ‘ID evidence’, for ID research and its results, but it seems that no ID evidence may be allowed by you.

Also, you haven’t answered to the next question:

Can you define your best version of the word ‘speciation’ and why the evolutionary concept of ‘speciation’ is not corrected to mean variation within compatible organisms (which is indeed the resulting evidence)?

In that way, as mturner declared, all the current and published 'evidence' provided by 'speciationists' does not support at all any Darwinian or neo-Darwinan scenario for the "origin of species".

Bottom line is:

How long evolution is going to deliberately and “conveniently” allow for the careless confusion of the fact of variation within compatible organisms with the speculative concept of ‘speciation’?

Can you define your best version of the word ‘speciation’ and why the evolutionary concept of ‘speciation’ is not corrected to mean variation within compatible organisms?

Other links related to this posting:

Chronicles for The Laupala Cricket Variation

From: Chronicles for The Laupala Cricket Variation

The point is that all studies on “speciation” can be easily replaced by the word variation, reducing the evolutionary deusion of ‘the origin of species’ to the facts of variation between compatible organisms.

Concluding: Genetic compatibility and a fertile offspring are the two key factors to identify varieties and to produce new biodiversity.

To go one step further than the current evolutionary ‘tar-pit’ of biology, we need to inject new views. ID offers those needed and renewed views and those new methods for a real revolution in biology.

Intelligent Design Discovered in Flies and in the Bees Flying Code

2006-01-18T09:17:00.000-08:00

Tethered fly from the front. Credit: Michael Dickinson and Tom Irving (from: http://www.livescience.com/images/h_fly_front_02.jpg)

Next we will see three examples on how to use the wonderful designs present in nature for our own robotics and medical study. We, a smaller engineer learning from the biggest engineer! Isn’t that what Intelligent Design with your support will be doing? ID should be making a free and most friendly environment for development and progress than the current one!

The first story, by Michael Schirber who posted on 27 January, 2005 The Flight of the Fly where he wrote: "... their [the Insects] amazing ability to turn their powerful flight muscles on and off so quickly,

"For an insect, it is too difficult to have an electrical signal go from the brain to the muscle 200 times per second," says Tom Irving of the Illinois Institute of Technology.

Instead – for many insects – the wing-moving muscles, which are located in the thorax, operate by something called stretch activation, wherein one set of muscles automatically fires when the contraction of the opposing muscle group causes it to stretch.
This internal feedback loop goes on without any nerve impulses from the brain."

"A fly, it turns out, will adjust the frequency of its wing beats to match what it believes to be its forward motion. By timing the opening of their shutter with the fly’s frequency, the researchers were able to record eight separate time steps of a wing beat. (You can see the X-ray movie in mpg, mov, or wmv format.)

"We were actually seeing the movement of the molecules in a cycle," Irving said.

The data indicate previously unsuspected interactions of various proteins as the muscles stretch and contract. The implications may go beyond insect flight.

"We might look for this mechanism in heart muscles," Irving said. "It opens up new questions for us."

Irving is quick to point out that the heart will not beat without a signal from the brain, but the processes in the fly’s muscles could play some part in how heart muscles work. If so, it may be possible to genetically engineer fruit flies to mimic some kinds of heart problems.

The second story, also by Michael Schirber who posted on 27 May 2005 Dancing Bees Speak in Code

From:http://www.livescience.com/images/0505_radar_bee_02.jpg

Bee with tracking device attached. Credit: BBSRC/Rothamsted Research.

"Bees outfitted with tracking devices responded to the wiggling of one of their fellow foragers, who had just returned to the hive from some newfound bee vittles. The dance... is performed on one of the honeycomb walls..."

"The central element of the choreography is a shimmy, or waggle, along a straight line. For emphasis, the bee repeats this move several times by circling around in a figure-8 pattern. The angle that the shimmy makes in relation to an imaginary vertical line is the direction to the food source with respect to the sun. For example, a waggle dance pointing towards 3 o’clock is bee talk for: "Hey, there’s food 90 degrees to the right of the Sun."

"This solar compass in honeybees was originally observed in the 1960s by the Nobel Prize winner Karl von Frisch. Later, it was noticed that the number of waggles in one figure-8 corresponds to the distance to the meal. These remarkable relations have been supported by other experiments, including one in which a mechanical bee danced for the hive and the real bees responded."

"The dance isn’t a trivial demonstration, but an abstract code," says J. R. Riley of Rothamsted Research, UK.

"This is the most definitive proof that recruited bees read the waggle dance, since the transplanted bees [another experiment described in that article] chose the foretold trajectory without any of the possible other cues – odors (bees have a strong sense of smell), landscape, other bees – that might exist along the true hive-to-feeder route."

Then we have the third story, which wisely MSNBC subtitled as:

Robotic wings mimic insects’ rapid beat and could inspire new designs

"In the last 10 years, flight biologists have gained a remarkable amount of understanding by shifting to experiments with robots that are capable of flapping wings with the same freedom as the animals." [Douglas Altshuler, a researcher at California Institute of Technology]

"The scientists analyzed pictures from hours of filming bees and mimicked the movements using robots with sensors for measuring forces. Turns out bee flight mechanisms are more exotic than thought."

"The honeybees have a rapid wing beat… In contrast to the fruit fly that has one eightieth the body size and flaps its wings 200 times each second, the much larger honeybee flaps its wings 230 times every second." [Altshuler]

"This was a surprise because as insects get smaller, their aerodynamic performance decreases and to compensate, they tend to flap their wings faster."

"In order to understand how bees carry such heavy cargo, the researchers forced the bees to fly in a small chamber filled with a mixture of oxygen and helium that is less dense than regular air. This required the bees to work harder to stay aloft and gave the scientists a chance to observe their compensation mechanisms for the additional toil. The bees made up for the extra work by stretching out their wing stroke amplitude but did not adjust wingbeat frequency."

"They work like racing cars," Altshuler said. "Racing cars can reach higher revolutions per minute but enable the driver to go faster in higher gear… "And this was just for hovering," Altshuler said of the bees. "They also have to transfer pollen and nectar and carry large loads, sometimes as much as their body mass, for the rest of the colony."

The scientists said the findings could lead to a model for designing aircraft that could hover in place and carry loads for many purposes such as disaster surveillance after earthquakes and tsunamis.

Douglas Altshuler (from: http://dickinson.caltech.edu/old/images/people_altshuler.jpg).

All of that is so nice... until carelessly Douglas Altshuler declared without any basis that "Proponents of intelligent design … have long criticized science for not being able to explain … how bees fly". Now Stephen E. Jones has taken a stand for ID to make Altshuler to document his claim or to retract himself. So, Altshuler, you better stick to the facts and keep your mouth shut, given the fact that you lack of basis for your bashing claims!

The Laupala Cricket Variation

2006-01-16T11:48:00.000-08:00

Last year, an Insect Systematist posted at ARN a Brief Communication’s title and abstract published by Nature purported to provide evidence of “Rapid speciation: observations match Darwinian theory”

The brief in question is related to crickets:

http://www.nature.com/nature/journal/v433/n7024/full/433375a.html

Tamra C. Mendelson & Kerry L. Shaw. 2005. Sexual behaviour: Rapid speciation in an arthropod. The likely force behind an explosion of new Hawaiian cricket species is revealed. Nature 433, 375-6, and Supplementary Info.

http://www.lehigh.edu/~inbios/pdf/Mendelson&Shaw_Nature05.pdf [broken link]

Even the subtitle indicates that such publication was a “likely” speculation, proven to be wrong by their current 2006 paper!

In the original one page long brief we can read that:

"Females prefer pulse rates of their own species [Mendelson, T. C. & Shaw, K. L. Genetica 116, 301–310 (2002), see below], so divergence in male song reduces the chances of interbreeding between species."

Personal mating preferences between what Mendelson & Shaw considers as different ‘species’ was just a theoretical behavioral estimate of the animals, those crickets that we consider as varieties within the same compatible organism.

Because those crickets are able to interbreed in the lab producing fertile offspring, those crickets are not an example of ‘speciation’ but of variation.

Even in their original 2005 Nature's brief it does not says that the interbreeding between them is impossible, the different song-preference, it is theorized, only may be reducing the “ability of interbreeding between divergent populations.” However, their recent publication has demonstrated that such is not the case:

Mendelson, T.C. and Shaw, K.L. 2006. Close-range acoustic signaling and mate choice in Hawaiian crickets. Behavioral Ecology and Sociobiology (PDF). [Broken link]

“We predicted that females would exhibit a shorter latency to mating with hybrid males whose pulse rates were more similar to the conspecific pulse rate of the female. However, neither hybrid by L. paranigra nor hybrid by L. kohalensis pairings showed significant differences in latency to mating among females mating with the slower singer, the faster singer, or both...

So, we read:

"...the hypothesis that the premating barrier between L. paranigra and L. kohalensis is maintained by the female’s preference for a conspecific male’s song at close range was not supported by the present study. When females were presented with male hybrids exhibiting a wide range of pulse rates, no relationship was detected between male pulse rate and either the frequency of, or latency to, mating. Rather, females of both species accepted males with pulse rates several standard deviations outside their respective conspecific ranges, indicating broad female preference functions for pulse rates at close range. Therefore, we are unable to reject the null hypothesis that the pulse rate of male “courtship” song has no effect on behavioral barriers in close-range interactions.”

“The two species do not overlap geographically, nor does available evidence suggest a cost to hybridization (i.e., a reduction in hybrid fitness).”

Next, more excerpts of their 2006 article demonstrating the resulting fertile offspring or F2:

“Matings between L. paranigra and L. kohalensis result in viable and fertile offspring, and the second generation of hybrids (F2) provide a genetic and phenotypic mosaic of parental types. Thus, although individual males are characterized by a particular pulse rate, the population of F2 males exhibited a broad range of pulse rates against a recombined genetic and phenotypic background... Males were second-generation hybrids resulting from a L. kohalensis grand-dam and L. paranigra grand-sire, and several F1 intercross parents.”

After the failure to demonstrate that the male's song is a factor of 'speciation' (which when properly considered is just variation within compatible organisms), the authors wrote in their most recent paper:

“In close-range encounters, aspects of chemical signaling may be important to mate recognition within species and may further reduce the probability of interbreeding among divergent lineages. The nature and strength of this barrier is yet unknown.”

Results

“Results of our study demonstrate that while strong behavioral barriers exist between these two species, variation in the pulse rate of male calling song did not predict female mate choice at close range. These results suggest a more complex architecture to mate recognition in Laupala than previously hypothesized” [from the Abstract]

As well as their: Hybrid mate choice trials

“Females did not exhibit a preference for either slower or faster hybrid pulse rates... As with mate choice, latency to mating was not correlated with hybrid male pulse rate.”

Next is the way in which Y.M. Parsons (from La Trobe University, Australia) presents those same crickets in the next link:

The Hawaiian cricket, Laupala [broken link]

http://genserv.gen.latrobe.edu.au/Staff/ymp/LaupalaResearch.htm

"Laupala (Trigonidiinae, Gryllidae) are small flightless crickets found on all the high islands of the Hawaiian archipelago. An conspicuous feature of Laupala is the diverse variation in male courting song between species. The 37 species within the genus are morphologically similar but can be distinguished on the basis of pulse rate differences in the male song..."

Again, those 37 different ‘species’ are only 37 varieties of genetically compatible crickets that are able to produce fertile offspring!

I posted at ARN that “I can see again and again that varieties are deliberately and conveniently confounded with species...”

"If two different animals can interbreed producing fertile offspring, they are just varieties, no matter if science classifies them as different species or even genera (as the living fertile example of the product of a false killer "whale" x dolphin)"

We can conclude that there are at least more than 150 varieties (mislabeled different ‘species’) produced from a single pair of cricket genetic colonizers that arrived to Hawaii. Next you can see a picture of a semi-transparent Cave-dweller Hawaiian Cricket, one of the very few "non-gross-me-out" cricket pictures (smile):

[photo taken by Bill Mull]

Note: However, with all of this evidence demonstrating that variation within compatible animals is what is going on in nature, the journal Science was erratic enough to include the very same article of 2005 (presented at the beginning of this posting), proven in 2006 to be a living example of variation within compatible and fertile offspring producers (F2 crickets), but not of 'speciation', however Science presented it as:

Breakthrough of the year: Evolution in Action. By Elizabeth Culotta and Elizabeth Pennisi. Science 23 December 2005: 310(5756)1878-79.

However, earlier both Andrew Rowell, and Casey Luskin debunked those calculated deceptions published in Science. The right title of that promotional published by Science must be Microevolution In Action. While I presented The Fraud of Evolution: Variation sold as Speciation.

Update (Jan 20):The response to the above mentioned Insect Systematist can be read at: Chronicles for The Laupala Cricket Variation.

Some of the other broken links rescued:

http://www3.lehigh.edu/News/V2news_story.asp?iNewsID=1062

http://www.umbc.edu/biosci/general/user/tamram/publications

http://www.nbb.cornell.edu/shawresearch.html

This was my preliminary compilation of compatible organisms:
http://www.reocities.com/plin9k/limiting-species.htm
And this is a compilation of references:
http://www.iscid.org/boards/ubb-get_topic-f-18-t-000034.html
The inspiring article:
http://www.reocities.com/fdocch/limitsfish.htm
Additional compatibilities explored in my blogs are:
http://fdocc.blogspot.com/2005/12/bioengineering-and-discovery-of-new.html
http://www.reocities.com/kubyimm3/adap1.htm
http://fdocc.blogspot.com/2005/12/dog-variation.html
http://fdocc.blogspot.com/2005/12/finch-variation.html
http://fdocc.blogspot.com/2005/10/gull-variation.html
http://fdocc.blogspot.com/2005/12/interbreeding-in-shorebirds.html
[I noticed that somebody copied my previous link information and posted it in the Wikipedia: http://en.wikipedia.org/wiki/Hybridisation_in_shorebirds]

http://fdocc.blogspot.com/2005/12/gasterosteus-variation.html
http://fdocc.blogspot.com/2006/01/cichlid-variation.html
http://fdocc.blogspot.com/2006/01/maggot-rhagoletis-fly-variation.html
http://fdocc.blogspot.com/2005/10/crayfish-variation.html
http://fdocc.blogspot.com/2006/01/elephant-variation.html
http://fdocc.blogspot.com/2006/01/my-last-comments-on-laupala-cricket.html
http://fdocc.blogspot.com/2006/02/more-adaptive-comparisons-of-cave.html

Compatible Mates Interbreed Producing Fertile Offspring

Index

Etc..., etc...

A Hero For The Ages

2006-01-14T06:09:00.000-08:00

Imagine the night sky in a place far from the city, where you can recognize each visible star by its most ancestral group or constellation...

On pursuing The Constellations and Their Intelligent Design we can follow the clear redeeming pattern (names above the constellation's figures):

ORION OVER LEPUS:

ARIES OVER CETUS:

OPHIUCHUS OVER SCORPIO:

LEO OVER HYDRA:

HERCULES OVER DRACO:

Here, the constellations representing a man are holding in their hands evidences of their victory: Orion, Ophiuchus and Hercules. All of them pointing to the same Hero For The Ages: Our Christ Jesus! That's The Witness of the Stars!

Back to Normal: Natural Reverse Mutations

2006-01-13T06:05:00.000-08:00

Yesterday we saw Robert E. Pruitt's discovery of how plants are able to Mend their Own Inherited Faulty DNA, now we will gather some links related to the well known natural reversal to normal, the "reverse mutations":

Thomas Hunt Morgan et al declared (Ref. 1, pp. 169-170): "we know that mutations and even "reverse" mutations actually occur". Since then, others have done additional discoveries in humans on this novel area of prospective medicine (2). Those examples of natural "reverse mutations" (3-5) are leading to the discovery of possible artificial treatments (6-8). And well, the precise mechanisms of such mutational reversion are still been studied (9-10). Other possibility is the use of palindromes in the attachment of two different genetic modules for the engineering of terapeutic proteins.

References:

1. Morgan TH, Sturtevant AH, Muller HJ & Bridges CB (1915). Multiple Allelomorphs. In: (same Authors), The Mechanism of Mendelian Heredity. Henry Holt and Company. New York.

2. Hirschhorn R (2003) In vivo reversion to normal of inherited mutations in humans. J. Med. Genet. 40: 721-728.

3. Wahn V, Stephan V, Hirschhorn R. Reverse mutations-- spontaneous amelioration or cure of inherited disorders? Eur J Pediatr. 1998 Aug;157(8):613-7.

"Some recent publications indicate that inherited disorders can ameliorate or possibly disappear if mutations responsible for the disease revert to normal. This review tries to summarize our current knowledge about reverse mutations as this information may be of special interest for attempts at somatic gene therapy."

4. Gross M, Hanenberg H, Lobitz S, Friedl R, Herterich S, Dietrich R, Gruhn B, Schindler D & Hoehn H (2002) Reverse mosaicism in Fanconi anaemia: natural gene therapy via molecular self-correction. Cytogenet. Genome Res. 98: 126–35.

5. Brown WT, Houck GE Jr, Ding X, Zhong N, Nolin S, Glicksman A, Dobkin C, Jenkins EC. Reverse mutations in the fragile X syndrome. Am J Med Genet. 1996 Aug 9;64(2):287-92.

"inherited a fragile X chromosome from their premutation carrier mothers, and yet had normal size FMR1 repeat alleles... Our results indicate that women identified to be carriers by linkage should be retested by direct DNA analysis."

6. Hacein-Bey-Abina S, Le Deist F, Carlier F, Bouneaud C, Hue C, De Villartay JP, Thrasher AJ, Wulffraat N, Sorensen R, Dupuis-Girod S, Fischer A, Davies EG, Kuis W, Leiva L & Cavazzana-Calvo M (2002) Sustained correction of X-linked severe combined immunodeficiency by ex vivo gene therapy. N. Engl. J. Med. 346: 1185-93.

7. Gaspar HB, Parsley KL, Howe S, King D, Gilmour KC, Sinclair J, Brouns G, Schmidt M, Von Kalle C, Barington T, Jakobsen MA, Christensen HO, Al Ghonaium A, White HN, Smith JL, Levinsky RJ, Ali RR, Kinnon C & Thrasher AJ (2004) Gene therapy of X-linked severe combined immunodeficiency by use of a pseudotyped gammaretroviral vector. Lancet 364: 2181-7.

8. O. Adjali, G. Marodon, M. Steinberg, C. Mongellaz, V. Thomas-Vaslin, C. Jacquet, N. Taylor, and D. Klatzmann. In vivo correction of ZAP-70 immunodeficiency by intrathymic gene transfer. J. Clin. Invest., August 1, 2005; 115(8): 2287 - 2295.

9. Bultman SJ, Klebig ML, Michaud EJ, Sweet HO, Davisson MT, Woychik RP. Molecular analysis of reverse mutations from nonagouti (a) to black-and-tan (a(t)) and white-bellied agouti (Aw) reveals alternative forms of agouti transcripts. Genes Dev. 1994 Feb 15;8(4):481-90.

"...we propose that reverse mutations occur by excision of inserted sequences in a through homologous recombination..."

10. English JC, Roser KS, Mecchi M. Conversion of tris(8-quinolinolato-N1, O8) aluminum to 8-hydroxyquinoline and activity in bacterial reverse mutation assays. Mutat Res. 2005 Apr 4;582(1-2):95-104.

/////////

Note:

These are additional findings that demonstrate patterns and non-randomness in such molecular events. Similar findings for the human polymorphisms, in the future will help to therapeutically reverse hereditary diseases.

Earlier, I reported at ARN some other examples in microbes:

"...under leucine starvation conditions, leu+ revertants accumulated as a function of time; leu- to leu+ reverse mutation rates and frequencies were higher than those under non starvation conditions."

"...reverse mutations could occur continuously in a time-dependent manner."

"...reverse mutation under leucine starvation was cell density dependent and growth-dependent."

Taken from an Online Journal: Jianling Jin, Peiji Gao and Yumin Mao. Occurrence of leu+ revertants under starvation cultures in Escherichia coli is growth-dependent. BMC Genetics 2002, 3:6.

And related to the non-randomness, even in mutations (that as we have seen here, can and do revert!):

"Base substitutions and single-base frameshifts, two major classes of spontaneous mutations, occur non-randomly throughout the genome."

Ref.: Hisaji Maki. Origins of Spontaneous Mutations: Specificity and Directionality of Base-Substitution, Frameshift, and Sequence-Substitution Mutageneses. Annual Review of Genetics Vol. 36: 279-303 (Volume publication date December 2002.)

See also:

"...directed variation must be invoked to understand some phenomena, as random variation and selection alone are not a sufficient explanation... The existence of such mechanisms has been predicted by mathematicians."

Ref.: Bernhard, R. 1967. Heresy in the halls of biology: mathematicians question Darwinism. Sci. Res. (New York) 2:59-66.

And also:

"... background mutations are sequence directed and not random in the sense that they occur in bases made vulnerable by virtue of their particular location within specific DNA sequences, such as tandem repeats, or the unpaired and mispaired bases of stem-loop structures"

Taken from: Barbara E. Wright. A Biochemical Mechanism for Nonrandom Mutations and Evolution. Journal of Bacteriology, June 2000, p. 2993-3001, Vol. 182, No. 11.

Again, as in my entry for yesterday, this facts point to the robust Stability of living organisms, designed to endure and to preserve their specified patterns, the integrity of their particular 'kinds' (Heb. Min, Gk. Genos.)

Mending Faulty Genes

2006-01-12T12:46:00.000-08:00

Plants Mend their Own Faulty DNA, by Apoorva Mandavilli
"Plants can correct defective genes inherited from their parents by reverting to an ancestral gene sequence."

"The parent generation had a mutant version of a gene dubbed hothead, which causes the plants to have fused flowers. Even when each parent carriet two mutant versions of the gene, 10 percent of the next generation had normal flowers... these plants had somehow retrieved ancestral code that allowed them to repair the mutant gene."

"Although the discovery was made in plants, [Robert] Pruitt suspects that animals, including humans, might also use this method to correct faulty genes."

"There's another way that genetic information can be inherited, which we've been blissfully unaware of the last 100 years or so," Pruitt says. "To me that just boggles the mind. Then you really start to wonder what else is out there"

My Comment: This finding, together with the studies in mutations' reversal indicates that instead of a darwinian evolving of organisms, life tends to stability (Stasis), to preserve and to perpetuate their given patterns.

Related Links:

Robert E. Pruitt's Lab

Science 25 March 2005: Vol. 307. no. 5717, pp. 1852 - 1853
News of the Week. GENETICS: Talking About a Revolution: Hidden RNA May Fix Mutant Genes, by Elizabeth Pennisi

Research News: Plant Inherits Repaired Gene
Listen to this story...
Talk of the Nation, March 25, 2005 · Researchers report finding that some plants may have a hidden mechanism for repairing damaged genetic material -- even when the plant received two copies of the damaged gene.
Guest: Robert E. Pruitt, associate professor of plant molecular genetics, Purdue University.

Heresy: Genetic 'memory'.

Intelligent Design in 'Achilles', a Song by Atom

2006-01-11T18:47:00.000-08:00

The Meaning of Messiah

http://www.atomthaimmortal.com/html/singleTopic.php?t=429

... winner of the Solo Artist of 2005

http://www.arn.org/_idarts/wordpress/?p=152

"We strike Achilles at his heel
We strike the modern man like Gregor Mendel,
meddling with his alleles
Wounds of Darwinian theory will never heal
Once the population finds Intelligent Design
Enzymes hold the signs of a divine Mind
Darwinian speculation is useless
To explain emergence
Of cellular machines below the surface
Seeing Specified Complexity points to a purpose
Of a system of intergrated parts
Excluding chance as part
Of how it could ever start..." - Atom.

Free full Album:
Redeemed Thought :: The Body of Christ - EP

Atom declared:

"I am down for the ID community"

Here we extend our congratulations to Atom!

The Dolphin Variation

2006-01-10T07:46:00.000-08:00

I prepared the next slide for my students as well as the next information (click on the picture, even twice, to enlarge it):

Taken from; http://www.reocities.com/plin9k/dolphins.jpg (Thanks to reocities.com for saving it!)

Interbreeding between Dolphin and false killer whale: There has been one case of a female bottlenose dolphin (Tursiops truncatus) and a male false killer whale (Pseudorca crassidens) producing a fertile female hybrid that has been called a wholphin. She, the offspring, went on to breed with a dolphin and produced a daughter in the Hawaii's Sea Life Park. Since the offspring in this case is fertile, these two 'genera' are really, by definition, a single polytypic biological species

Note: Other members in the group (12 living 'genera') are much more alike than the two that produced this offspring in Hawaii.

MacLeod declared: "...in the order Cetacea, there appears to be few, if any, postcopulatory species isolating mechanisms as successful hybridization between many species, genera, and even sub-families have been recorded."

MacLeod, C. D. 2000. Species Recognition as a Possible Function for Variations in Position and Shape of the Sexually Dimorphic Tusks of Mesoplodon Whales. Evolution, 54(6):2171-3

References:
Fraser, F. C. 1940. Three anomalous dolphins from Blacksod Bay, Ireland. Proc. R. Irish Acad. 45(B):413-455.
Nishiwaki, M., and T. Tobayama. 1982. Morphological study on the hybrid between Tursiops and Pseudorca. Sci. Rep. Whales Res. Inst. Tokyo 34:109-121.
Reyes, J. C. 1996. A possible case of hybridisation in wild dolphins. Mar. Mamm. Sci. 12:301-307.

A great website that presents the three, dad, mom and daughter jumping at the same time to allow us to compare their size differences: In my article submitted to ISCID, "Intelligent Design to Generate Biodiversity", I answered to the excellent comments posted by Stuart Harris and by Jerry D. Bauer:

The first practical and elementary genetic formula to be used here is:

If:

(3) P1 + P2 = F1 Fertile

Then:

P1 and P2 are just varieties of the same kind or 'genos' (as we read in the book of Genesis) of organism, no matter how morphologically different they may appear.

This will be further illustrated with this dolphin striking example, also mentioned in my article:

If:

(4) Pseudorca crassidens + Tursiops truncatus = F1 Fertile

Where:

Pseudorca crassidens = male false killer whale (14-foot, 2,000-pound)

Tursiops truncatus = female Atlantic bottlenose dolphin (6-foot, 400-pound)

F1 Fertile = a fertile female called a 'Wholpin', that itself has been able to conceive in three different occasions, her first calf lived for 9 years, the second died when born and this third one [its offspring], a female, a putative product of this F1 female interbreeding with a 8-foot long Atlantic bottlenose male dolphin was born last December 2004.

Then:

Pseudorca crassidens and Tursiops truncatus are just varieties of the same kind or 'baramin' (according to current nomenclature) of organism, not a different 'genus' [or as the Bible presents it to us, the same and compatible 'genus', not an 'evolving', different and incompatible, as gathered by using the uncertain scientific nomenclature of (misclassifying them as) 'genus'], as it is wrongfully and currently held by evolutionary scientists.

No matter how morphologically different they may appear and in disregard of the common names given to the involved animals (false killer whale, dolphin, wholphin), these are just varieties of dolphins!

Still, you won't read this full successful F1 (Pseudorca x Tursiops) x Tursiops interbreeding story in indexed journals, at least not yet...

Pro Darwinians will want to continue the winnow game by watering down this great example of variation by saying that this only happened once and 'in captivity', but that this 'does not happen normally in the wild'. The fact is that they, these P1 and P2, have a 'genetic compatibility', as Stuart Harris declared, no matter their 'psychological mating preferences', as Goldschmidt may have said it.

This 'psychological mating preferences' is an aspect overemphasized in the current neo-Darwinian 'mind-game' of 'divide', in the darwinist's attempt to 'prove' a fallacy, they want to convince everybody that new 'species' are emerging all the time, when what we really see all the time is just varieties within the same kinds (genetic compatible groups).

The sheer fact is that those misnamed varieties of dolphins can interbreed producing fertile offspring!

And like this, I have seen that the misclassification of varieties as if pertaining to different species or worse, to different genus, like in the example provided here, can reach the hundreds of thousands!

But, oh well, that's not important right now for the evolutionists, as far as they keep high the public ignorance in regards to this topic, in their attempt to keep promoting their sterile 'speciation' fallacy...

While evolutionists now try to violently stop alternatives to their views, they think that on doing so their failed evolutionary multi-theories may still 'afloat'. But thanks God that today we have 'the Internets' (smile).

A related example can be seen in the HybriDatabase (confirming MacLeod's statement , substantiated by Fraser, by Nishiwaki and Tobayama, and by Reyes, etc.):

Hyb. # 1693. Grampus griseus x Tursiops truncatus. Intermediate characters suggest natural hybridization [Gray AP 1972]

This last one found using the: http://www.bryancore.org/hdb

Concluding: Then, by using this Intelligent Design perspective, we can predict also that the real 'killer whale' is just the ‘Saint Bernard’ of the dolphins, and that is able also to interbreed producing fertile offspring with the rest of its genetically compatible 'mates', being them the rest of the real varieties of dolphins!

Update: After posting this example at ARN, I received a note from the original webmaster that took and posted those amazing pictures, linked here:

The photos were actually provided by Sea Life Park for the Waimanalo News (now defunct) that i was helping to get online many years ago.
You take care.
Aloha,
Rabbett

You may also want to read The Fraud of Evolution: Variation sold as Speciation as well as Microevolution In Action.

The Intelligent Design of Nick Anderson's Cartoons...

2006-01-08T12:15:00.000-08:00

...consists on he hiding the names of his two sons (Colton and Travis) in all his cartoons.

In the original, you can see the name of Travis in Anderson's back and at the bottom left of the mirror's frame, while 'Colton' is in Anderson's tie and at the top of the mirror's frame (here highlighted in red).

In the Houston Chronicle of today it says that he is joining its Editorial Cartoon:

Pulitzer winner joins Chronicle

If you think that he really looks like the cartoon of himself (posted here side by side), in the same way he may be distorting what his imagination dictates related to other issues... (smile):

This one he Published On 2005-11-29: "Teach both sides! Teach intelligent design! Intelligent design is science!"

And in this other he represented the Roman Clergy supporting Evolution.

Next, one Anderson's awarded Cartoon:

Other of his cartoons related to the wiretap spying on America:

And a couple more in black and white:

http://www.cartoonistgroup.com/store/add.php?iid=4407

http://www.cartoonistgroup.com/store/add.php?iid=4400

Incan Khipus Defy Computer Analysis

2006-01-07T15:27:00.000-08:00

The next is the number 55 of the 100 top science histories for 2005 according to Discover magazine:

Are Incan Knots A Crackable Code?
By Anne Casselman [Discover, Jan. 2006, 27(1):40.]

A khipu from the Nazca River valley is so elaborate that it has defied computer analysis.
Photo Courtesy Gary Urton, Museum of Ethnology, Sweden.

The Incas didn't leave any written words behind, but they did leave behind khipus—knotted, colored, and twisted textile strings that seemed to serve as a record-keeping system for the largest state in the ancient New World.

In August Harvard University anthropologist Gary Urton and his colleague Carrie Brezine reported the first clear signs of shared information embedded in 7 of 21 khipus from Puruchuco, an Incan palace and administrative center on the coast of Peru.

"For the first time we've been able to see khipus that are communicating with each other," says Urton.

Urton and Brezine also found a series of three figure-eight knots repeated in some of the seven Puruchuco khipus. They believe this redundant element may code for the town itself or its khipu keeper.

Finding information that extends beyond administrative inventory is especially tantalizing...

"If we learn how to read and interpret these khipus, it will for the first time allow us to see inside the empire from the point of view of the people who lived in those times themselves," says Urton. "And if it turns out to be a system of writing, then it sort of throws open the question of what writing is."

Historian Leland Locke first determined in the 1920s that khipus contained numerical data.

By the 1970s Cornell University anthropologist Robert Ascher, and his wife, mathematician Marcia Ascher at Ithaca College, concluded that more than 20 percent of the khipus were nonnumerical.

In 2002 Urton began consolidating minutiae about more than 700 surviving khipus as part of the Khipu Database Project.

"Ultimately, what we want to do is decipher the khipus or at least determine whether they are decipherable or not," he says. "And that's a question that's still open."

More Pictures on Khipus (also Quipo or Quipu):

http://www.mamani-inca.com/khipu.html

Gary Urton & Carrie Brezine colection:

From their site: http://khipukamayuq.fas.harvard.edu/KGMiscellaneous.html

Three Rivers and Six Fingers Thrice

2006-01-06T15:26:00.000-08:00

Inhabitants of a nearby village made the Three Rivers petroglyphs (rock carvings)... Over 20,000 ... have been identified in the area.

The people were of the Jornada Mogollon prehistoric Indian culture, of which there are no known modern descendants.

The petroglyphs' purpose and meaning are not entirely clear... Many almost certainly had religious meaning. The ridge may have been a good lookout point, a sacred site, a stop on a trade route, or a point on a territorial boundary. The petroglyphs have endured here for centuries... this fragile resource...

Well, yeah, we went to Three Rivers, New Mexico a week ago and some of the pictures seen there are presented here:

The most impressing petroglyph that I saw was the next one, found at "the sacred ridge":

Petroglyphologist Nile Root (1926 - 2004) declared of it:

This image of a hand with six fingers exemplifies the mysteries that we will never be able to solve as we ponder the rock art at Three Rivers.
The hand reaches toward the sky with a wavy design over it. (A snake? The Milky Way?) Celestial designs are to the right; below is another hand with only five fingers.

Another view of the same six finger petroglyph, courtesy of the Anderson Family can be seen below this line, and a third one of the same six fingered petroglyph can be seen in black and white (below, from: http://www.vivanewmexico.com/petro3l.jpg).

Apart of this six fingered hand, there are other two more six fingered hands at Three Rivers, the next one is the evidence painted by Fredric H. Cowart II (his drawing below. Note: dear reader, if you have a picture of this one depicting two hands, each with six fingers, please, post it on a link); Cowart thus declared of this 'six fingers twice' petroglyph, which he painted in his Sketchbook "The Best of Three Rivers", 2001, pp. 44-45, and for which he devoted his longest writing:

"It is a pet theory of mine, shunned by other scholars, that a special six fingered shaman may indeed have presided at Three Rivers. In his society he would have been elevated - rather than diminished - by his deformity. Such an individual, a man of the rainbows, who benefited enormously from his polydactyly, would already possess the attributes of a superman in the eyes of his people. Supplications would have come from abroad to receive his pronouncements and his medicine. His ability to heal and to control the weather would have been renowned. Even the bravest of the war chiefs would have quaked before his wrath, and the people would have sought his advice and judgment in all matters of importance. The icon of one of his special hands appears again, a third time, on the sacred ridge at Three Rivers [here, presented above]" (F. H. Cowart II)

Even when today, from time to time a person appears with six fingers in one hand or six toes in one foot, the individual represented in Three Rivers seems to have had 6 fingers in each hand! Similarly, the next one described in the Bible, had six in each extremity (24 in total)! (a genetic aberration):

2 Samuel 21:20
There was war at Gath again, where there was a man of great stature who had six fingers on each hand and six toes on each foot, twenty-four in number; and he also had been born to the giant (Heb. Raphah or Rapha, product of the Rephaim living within the Canaanite Philistines).

The Bible confirms this record by repeating it:

1 Chronicles 20:6
Again there was war at Gath, where there was a man of great stature who had twenty-four fingers and toes, six fingers on each hand and six toes on each foot; and he also was descended from the giants [Heb. Rapha].

Verses found using http://www.redtext.com/

The next pteroglyph, at the beginning of the trail, Cowart entitled "The Monster Mask":

While the next one presented here is a human face (Andersons' courtesy); Fred H. Cowart the Second called this one "Figure, wearing earrings" and declared of it:

"Several scholars have mentioned the "almond-shaped eyes" used by Jornada Mogollon craftsmen in their depictions of faces and masks"

The next are animals that the Anderson Family was able to photograph, a long nosed mammal; a fish; A wolf falling over a deer.

Then, incomprehensible messages were also present, encoded presumably by the same Mogollon craftsmen:

Three ram-heads can be seen distributed among a cipher; then, five like cups aligned, one of them falling at the left side; the next one seems like dots or planets. The next one particularly aroused the curiosity of Fred Cowart who did its drawing and entitled it:

"The Typewriter Petroglyph"
"What is it? A counting board? A lunar calendar of recorded full moons?" (Idem, pp. 16-17.)

As we saw earlier, and related to particular puzzles, an Intelligent Design perspective can be used in Archaeology to define and to find common patterns and messages, and the very same can be said for Biology.

Common Patterns in the Ancient World, their Pyramids and gods

2006-01-04T09:09:00.000-08:00

The hypothesis that we present here is that by studying the Archaeological patterns for the non-Israelite cultures of the old world, we can identify their common elements.

Babel’s tower, and all the ancient Babylonian ziggurats preserved until now are similar in purpose and design to the ancient American pyramids, used with the purpose of interacting with their gods in their high places. Please, compare by yourself the Babylonian ziggurats:

http://lib.haifa.ac.il/www/art/ur.html

With Pre-Columbian pyramids:

Aztec,

http://www.hope-of-israel.org/aztec.htm

Maya,

http://www.ocasa.org/MayanPyramid.htm

[Note: Here, apart of the 'captivating' Maya audio effect, you need to remember also the precise mathematical design of that pyramid in correspondence with the sun (“the spring equinox shadow” of the sun, ending in the stone head of the serpent) to simulate the “Descend of the serpent” and re-enacted for tourists night after night, with the use of artificial lights].

Moche,

http://www.huacas.com

And with Chinese pyramids:

http://www.crystalinks.com/pyramidchina.html

And also with the Japanese, now uderwater, pyramids:

http://www.morien-institute.org/yonaguni_schoch1.html

Not to mention their exhuberant material in Egypt.

One purpose of the pyramids was to establish interaction with their gods, as we read of the ziggurat of Babel’s tower, which:

“was crowned by a temple where the god was thought to descent for intercourse with mankind” (D. J. Wiseman, University of London, The New Bible Dictionary, 1962, p. 117)

Another deplorable activity performed at the top of the pyramids, or on the high places, like over the mountains and mounds, was the human sacrifice with the purpose to beg or to calm the moody gods of the heathen (the demons or fallen angels).

A third activity performed at the top of the pyramids was to 'predict' times and seasons for their towns and individuals through the use of astrology, a perversion of the ancient revelation preserved today in the Biblical astronomy as followed by the wise-men of Persia when they visited the little boy Jesus.

At the top of Tulum, Coba and other high sites, the Maya preserve the figure representing “the god that descends” (with similar features to some Hindu head-dress representations; also notice its Babylonian wings), also called the “god of the bees” (while the Bible defines for the heathen practices, “the god of the flies” or Baal). That Mayan god is represented as descending to interact with humans, and most specifically, to intimate with human females.

http://www.reocities.com/kubyimm2/image021.jpg

In the old book of “Mexico Through the Centuries” (“México a Través de los Siglos”, Vol. 1), by Riva-Palacio, we found the next pre-Columbian graphic, interpreted there as the sun descending over the earth at the sunshine, but we can also identify the allusion to the previous figure representing one of their gods descending (a fallen one over a woman):

http://www.reocities.com/kubyimm2/image023.jpg

The same feature of a monster-like face over a female face is recurrent in the Maya artcraft:

http://www.reocities.com/kubyimm2/image029.jpg

Next is a representation of the Maya 'monsters' over a victim, a young one under its stool:

http://www.reocities.com/kubyimm2/image027.jpg

In the same way that Eve was deceived by a serpent, the spiritualism or spiritism of the pre-Columbians includes a materialized serpent as the provider of wisdom...

Evils spirits posing as their gods (the fallen ones) were materialized at the eyes of the Maya once the offering of human blood was presented to them (Lintel 15 (Yaxchilan), “The Rearing Vision Serpent”), those evil spirits appeared with serpent bodies and human heads (“the long looping body of the Vision Serpent transforming into the torso of K’awil (“cavil” in Poqom Maya (compiled by Fray Pedro Moran (1720) and by Fray Diego Zuñiga (1608), studied by Susan Miles (1957)), and “q’abwil” in Maya K’iche (Quiche) and Kaqchikel, meaning “gods”, as well as their “carved images”, and the fact that those 'gods' are “volatile”, pp. 194, 443, Freidel et al, 1993, Maya Cosmos, Quill William Morrow, N.Y.)”; or the head of a “human” “emerging from the mouth of the serpent”, “Yat-Balam, founding ancestor of the dynasty of Yaxchilan, emerging from the mouth of an enormous Vision Serpent", called “nawal of the founder”, pp. 184-5, 196, Freidel et al, 1993), in Lintel 13 of Yaxchilan we can see the son of Jaguar-Bird emerging from the mouth of a serpent (“being born from the snake”, p. 219, Freidel et al, 1993).

An example (human blood-shed offering to their gods (and an evil spirit appearing in the shape of a serpent with a human head emerging from it, and giving instructions to its unaware female “victim”):

http://www.reocities.com/kubyimm2/image033.gif

“The war snake (“the great war serpent”, p. 207, “with a half flayed body decorated with feather fans”, p. 208), named Waxaklahun-Ubah-Kan, the Maya War Serpent appears with the tok’-pakal (the flint shield) in a lintel (Yaxchilan Lintel 25), showing the king’s principal wife, Lady K’abal-Xok (in: A Forest of Kings (Schele and Freidel, 1990:262-305), the full recounting of her story) communing with “the ('spirit of the') founder of (her husband’s, Freidel et al, 1993, p. 208) lineage” (an evil spirit posing as an ancestor, like in the medium's seances), after Shield-Jaguar had conjured him up through bloodletting during his accession rite. Holding a bowl full of paper splattered with her blood, she kneels gazing up at Yat-Balaam, the founder, emerging from the Waxaklahun-Ubah-Kan, the transformed war monster originally imported from Teotihuacan” (Freidel et al, 1993, p. 308).

“Precolumbian Maya practiced bloodletting... to enter vision rites and ecstatic trance and to commune with the gods... communication with “the Otherworld”... (Freidel et al, 1993, pp. 207-8).

Other "Vision Serpents" can be seen in the modeled stucco example from Group H, Waxaktun, currently dated to the Late Preclassic Mayan period (see Schele and Freidel, Forest of Kings, 1990, Chapter 4), and a black-line graffito on the wall of Structure 5C-2nd at Cerros, Belize. This graffito shows a tau-toothed god or ancestor in the mouth of the Vision Serpent, the earlier example of this kind of depiction so far. Current work in the Preclassic ruins of the Maya region will no doubt push this concept back even further in time (Freidel et al, 1993, p. 447, Note 71)

“Kisin takes the form of a large snake called Ochcan (och-kan), which is described as being very big... having a large shiny eye. When the initiate and the ochcan meet face to face, the alter rears up on his tail and, approaching the initiate till their faces are almost touching, puts his tongue in the initiate’s mouth. In this manner, he communicates the final mysteries of sorcery [final initiation of a Q’eqchi’ shaman in the village of San Antonio]... The master had previously removed all his clothes and was standing nude. The snake [“spirit” dragon] came up to him and after licking him all over, proceeded to swallow him whole. A few moments later he passed him out of his body with excrement. The master didn’t appear to be much the worse for his adventure. Very similar initiation ceremonies in Chiapas are described by Nuñez de la Vega (1700, which describes a cave as the location of the initiation ceremony) [Q’eqchi’ shamans in the village of Sokotz, Belize]” (Thompson, J. E., Ethnology of the Mayas of Southern and Central British Honduras, 1930, Field Museum of Natural History, Pub. 274, Anthropological Series Vol. XVII, No. 2, Chicago, pp. 68-9, 109-10).

“Ancient Maya drew ropes and bark paper through their tongues to conjure up Vision Serpents [some of the texts that record the conjuring of Vision Serpents may refer to bringing spirit[s] (evil spiritual possession) into these living snakes]... blood-splattered paper and bloody ropes... kings drew through their penises and kings and queens drew through their tongues...” (Freidel et al, 1993:205, 209, 448, Note 76).

“Och-Kan, the animal spirit (vision serpent, also the name of the “boa constrictor”) companion of K’awil (a “god”) emerges from a ceremonial bar” (pp. 198, 196, 448 (note 73), Freidel et al, 1993):

http://www.reocities.com/kubyimm2/kawil.jpg

“Flint-headed sun god emerging from a double-headed serpent bar on Copan stela A [Note: that reminds us of the deliberate lengthening of the head practiced by the Inca, also seen in the Egyptian Akenaton (see pictures in Apr. 2001, Natl. Geographic, “Pharaohs of the Sun” (in Amarna, their Sun god Aten, Akhenaten (born Amenhotep IV), Nefertiti, Kiya (his lover), and Tutankhamun), pp. 34-57 ), in the Olmecs, etc.]” (p. 199, Freidel et al, 1993):

http://www.reocities.com/kubyimm2/flint-head.jpg

Then we read in National Geographic, 1999, Vol. 196, p. 48, & in National Geographic 1996, Vol. 189, pp. 76-77:

“Unruffled after 500 years on Ampato (in the Peruvian Andes)... lightning had clearly hit the third grave found on this peak. The bolt consumed a child’s flesh, leaving bones and scraps of charred clothing... Jagged scars mark spots where heat fused the surrounding earth to the ceramic.... “the weirdest things can happen with lightning” (says Johan Reinhard, researcher/discoverer of the articles)... buried apart, a silver (small statue of a) llama (height:1.5 Inches) likely stood for the herds that petitioners hoped would multiply... The fairest children were costumed, feted, and perhaps buried alive with ceremonial objects in “sacred locations”. The Inca saw mountains as especially important sites...” In National Geographic, 1997, Vol. 191(1), p. 40 we read: “neither bones nor teeth show signs of disease or malnutrition. The Inca chose a perfectly healthy girl (or a boy, p. 42) – about 14 years old and four feet ten inches tall – as a gift to their gods”

http://www.reocities.com/kubyimm2/image039.jpg

Likewise, as the animal-human mixes found in other of the ancient heathen cultures of the world (i.e., bird-human Isis in Egypt, the Elephant-human Govind in India, the multiple human-animals in the Greek Mythology, the human-jaguar of the Olmecs, etc.), so, the Maya had their own, like the next example of an anthropomorphic figure with head of bird found in Palenque, confirming the link between heathen beliefs among ancient cultures:

http://www.reocities.com/kubyimm2/image025.jpg

For now, we can conclude that even if the old world humanity was extremely intelligent (with each human living for a long span), all of them were cultures that deliberately or by inheritance rejected, ignored or did not knew the original revelation of the benevolent and just God, our eternal and almighty God. Thus, their beliefs sided with destruction and sided with death... both, common elements in all the heathen traditions of the world.

Other Links, like the BBC - PBS - Nova Inca TV shows: http://www.pbs.org/wgbh/nova/icemummies

http://www.pbs.org/wgbh/nova/peru

http://www.mysteries-megasite.com/main/bigsearch/mummy-1.html

http://www.lib.unc.edu/house/mrc/films/full.php?film_id=2292

http://www.nationalgeographic.com/bookmarks/reinhard/index.html

http://www.mountain.org/work/andes/icemaiden.cfm

http://library.thinkquest.org/J003409
"Mummies Unwrapped" looks at mummies from different ancient cultures, Web by students, the site explains, "a lot of…mummies have been intentionally, or accidentally processed in sand, tar, or mud; freeze-dried in a cave; or sacrificed in a bog."

Related to sexual diseases and degeneracy by consanguinity in the pre-Columbian world (similar to the rest of the ancient world) we can read the next:

“The 9,000-year-old skull revealed auditory exostosis... Mummies found at Chinchorro site in Chile (and in: Antofagasta, Cobija, Tocopilla, Patillos, Inquique, Pisagua, Arica, Ilo, etc.) show evidence of bone infection, degenerated vertebrae, and possibly syphilis” [Iván Muñoz & Juan Chacama, Universidad de Tarapacá, National Geographic, 1995, Vol. 187, p. 73].

The Elephant Variation

2006-01-03T09:43:00.000-08:00

Encouraged by the most recent (02. January 2006) Dr. Beling's and Dr. Davison's postings to my Intelligent Design studies, I wish to answer with what I have found related to The Elephant Variation:

"An Asian elephant cow, "Sheba" in Chester Zoo, England, November 7, 1978 gave birth to a calf with an African elephant bull "Jumbolino" as the father. The male calf named Motty died two weeks after its birth. It was an early birth and Motty had stomach problems."

"[Being this the first report on interbreeding between] The Asian elephant Elephas maximus and the African elephant, Loxodonta africana... a crossbreed between two genus was regarded as impossible."

http://www.greenapple.com/~jorp/amzanim/hybridnew.htm (broken link)

http://www.hybridelephant.com/motty.html

The same example has been addressed by the Woodland Park Zoological Society from Seattle:

Can African and Asian elephants interbreed?
Yes. A hybrid birth did occur in England at the Chester Zoo in 1979. The calf, which was named "Motty," only lived 10 days. This is the only recorded hybrid birth between Loxodonta africana and Elephas maximus, the African and Asian elephant.

But, let's see elephant examples separated by a less distance than the continents:

Let's see first an example related to other varieties of elephants currently mislabeled as different "species" by the "wisdom of the world", on varieties of elephants recently discovered:

Geneticists define new elephant species, by Susan Milius, reporting on the article by Nicholad Georgiadis and Alfred L. Roca [Roca, A.L., N. Georgiadis, et al. 2001. Genetic evidence for two species of elephant in Africa. Science 293(Aug. 24):1473.]

However, even with the best evolutionary wishes by the previously linked editors of the magazines of Science (Indexed) and National Geographic (Not Indexed), the full text of Susan Milius itself declares that

"Savanna and forest elephants interbreed"

So, according to what we now know, those diverse elephants described by Roca et al should be only considered as 'sub-species', even if currently, the status of "species" for fertile inter-breeders able to produce fertile offspring is misguided and follows after the spirit of error that controlled Darwin and his current followers. Which means that by using minor molecular (genetic) insignificancies and intricacies, Darwinists deliberately forget the big picture of the evident biological breeding already available out there for everybody with a sound mind to see!

The next articles prove that Darwin and the current "speciational evolutionists" are deliberately and intentionally wrong, aiming to deceive the unawares:

The two forms interbreed where forest and ecosystems meet [Duncan Butchart, CC Africa & the WildWatch]

"Dwarf African elephants inhabit the forest lowlands and interbreed with the larger form around the forest edge" [The IFAW, International Fund for Animal Welfare]

"These three elephants can interbreed [David Woodruff talking about the forest and the savannah and the West African Elephants]"

"Unexpectedly, along the Congo-Uganda border the two species do interbreed [Dr Colin Groves, Australian National University, talking about the smaller Forest Elephants and the Bush Elephants]"

Etc... etc...

With such evidences, you need to reach your own conclusions and to answer by yourself to the next questions:

1. Is the current biology dominated by Darwinian evolutionism willing to depict faithfully the relationships between living organisms or not?

2. If not, why not?

3. What are atheists seeking to "gain" by investing millions & millions on distorting the simplest (to understand) biological facts of fertile interbreeding and fertile offspring versus their super-inflated & non-granted and Darwinian or evolutionary "speciation"?

Being Speciation the false origin of new and genetically incompatible "species" from a "common ancestor"; a "common incompatible ancestor" that itself was presumably incapable to interbreed producing fertile offspring with both of its descendants, because and supposedly, also the "always extinct" common ancestor itself was genetically different to the point of being incapable to mate, if still existing, with any of its new and aberrant offspring products, aberrant offsprings at least when compared with their ever utopical "common & incompatible ancestor..." !!!

And these are the sort of inconsistencies that evolutionists are bringing to living organisms in order to keep afloat Darwin's trends of thoughts, not to say their innumerable falsehoods and absurdities stored for the silent and already extinct organisms!

If there is no genetic incompatiblity between two related organisms, then there is no speciation at all, no matter how Schluter, the Grants and company are trying to excuse their, such a poor, logic by declaring that "several studies have demonstrated that speciation can occur in the absence of genetic incompatibilities"

If there is no genetic incompatibility, there is no "origin of new species", there is no "speciation", there is, yes, the "origin of new compatible varieties", there is yes, "variation" within compatible organisms, every group of organisms reproducing according to their own kind as Genesis 1 declared!

4. Is such biological anarchy speculated by both, Darwin's "Origin of Species" and by the current evolutionary and speculative research on "speciation" a "bad" original design or rather, and most certainly, a "very bad" and dying evolutionary theory, totally flawed in its "logic" and "reasoning" even if today still is completely aided by its blind followers seated in "high places"?

Index 2 for Research on Intelligent Design

2005-12-31T11:20:00.000-08:00

Research on Intelligent Design:

INDEX (Thur., Nov. 10 – Sat. Dec. 31, 2005)

# TITLE
1. The Intelligent Design Management of Wildlife, 11-10-05
2. Habitable Zones in the Universe, featuring Dr. Guillermo Gonzalez, Fri Nov 11, 2005
3. Irreducible Complexity in Interacting Systems, Nov 15-05
4. Estimating prevalence of protein sequences adopting functional folds, 11-16-05
5. Origins of introns based on definition of exon modules and interfaces 11-17-05
6. Problems with Characterizing the Protostome-Deuterostome Ancestor, 11-18-2005
7. John A. Davison and the discrete nature and stability of species, Tue Nov 22, 2005
8. Bionanomachines in Japan and Intelligent Design classes in Australia, Nov 23 2005
9. Lyr. "Accidentally" (R. Gootee, PFAL) in God’s U.S.A. Thanksgiving Day! 11-24-05
10. Non-Linear Biology, Independent Convergence and Independent Solutions. 11-25-05
11. Design principles of a bacterial signaling network, Saturday, November 26, 2005
12. Limits of Nanotechnology: The Molecular Motors!, feat. Dr. Dembski. Nov 30, 05
13. The Finch Variation, Friday, December 02, 2005
14. Protein Folds: Laws of Form Revisited, featuring Dr. Mike Denton. Mon 12-05-2005
15. Tiny Tweezers, featuring Mike Gene and Salvador Cordova. Tuesday, Dec 06, 2005
16. The Micro - "Pentagon", featuring Denise O'Leary. Wednesday, December 07, 2005
17. Integrated Multiple Interdependent Patterns for Biomolecular Analysis, Chiu, 12-8-05
18. Unexpected Gene Expression; our Entrance to the Inner-World of the Cell, 12-9-05
19. Audio File: Shermer vs. William A. Dembski Radio Debate, Sat December 10, 2005
20. Dilbert, from Sunday Comics to Serious Debates, f. Scott Adams. Sunday 12-11- 05
21. Degradosome Function: The Importance of Location, by Mike Gene. Mon 12-12-05
22. Behe's Irreducible Complexity Revisited by Dembski and by Gene, Tue Dec 13 2005
23. Gasterosteus Variation, Wed Dec 14, 2005
24. The Origin of Biological Information and the Higher Taxonomic Categories, S Meyer
25. Bioengineering and The Discovery of New Organisms, Thur Dec 15 2005
26. The Dog Variation, Friday, December 16, 2005
27. Intelligent Design in Archaeology and in Biology, Friday, December 16, 2005
28. A Possible Link Between Centrioles, Calcium Deficiency and Cancer, Dec 19, 2005
29. Reverse Engineering Assumptions for an Open Science Intelligent Design Theory
30. Interbreeding in Shorebirds, Tue December 20, 2005
31. Chance and necessity do not explain the origin of life, Trevors and Abel, Dec 20-05
32. DNA Shows Neandertals Were Not Our Ancestors, Tue December 20, 2005
33. Decoding Intelligence, Joerg Arnu and Clark, Tue December 20, 2005
34. The Maya and Archaeological Decoding, Tue December 20, 2005
35. The Decision of Jones (Intelligent Design’s rejecter, plus comments), 12-20-05
36. Intelligent Design in Culture (Dilbert, Opus, Boston Legal, Agency..), Wed, 12-21-05
37. The Constellations and Their Intelligent Design (A New Year's Special !), 12-31-05
38. This is Index 2 for the Research on Intelligent Design, Sat. 12-31-05
39. Previous, Index 1 for Research on Intelligent Design, Mon, Oct 31, 2005

The Constellations and Their Intelligent Design

2005-12-31T10:03:00.000-08:00

As my special delivery for this New Year's Celebration, I want to link here one exciting topic for me dealing with the most ancient human memory of the origin and meaning of the Constellations in the Night Sky!

In the magazine Astronomy for January 2006, in page 22 we read an article in the section Phil Harrington’s Binocular Universe entitled:

A Hero For The Ages

That article describes details of Greek mythology related to the constellation of Perseus, the savior, Cassiopeia, the saved by him, and of Cetus, the defeated monster.

Then I bought the magazine Sky and Telescope for January 2006 and in page 54 we have the section “Northern Hemisphere’s Sky” by Fred Schaaf and in p. 59 “Southern Hemisphere’s Sky” by Greg Bryant, being both articles devoted to the study of the constellation of Taurus.

The remark of Schaaf is that

“Two of Taurus’s best sights were even more glorious when woolly mammoths roamed the Earth”

while Bryant declares that

“The celestial bull dates back perhaps 6,000 years and is among the oldest constellations”

If that is so, why not to learn to read the sky according to an even older tradition than those in Greek Mythology? We need to learn of the meaning of the Constellations and of the SIGNS as preserved by the Middle East in their most ancient Books and in their most ancestral and still used etymologies:

http://philologos.org/__eb-tws (full download version of the classic book The Witness of the Stars, by Ethelbert W. Bullinger)

There we need to carefully read which was the original meaning of Perseus, and which was the ancestral meaning of Cassiopeia and who is really represented by Cetus

PERSEUS:

CASSIOPEIA:

CETUS:

The main Ecliptic Chapter, the leading Constellation of this group (Perseus, Cassiopeia and Cetus), is the SIGN of Aries:So, according to the most ancient Constellations' references found by Ethelbert W. Bullinger, the real Hero For The Ages represented by the Ram Aries offering his life for the redemption, and represented by Perseus rescuing Cassiopeia from Cetus, is no more and no less than the Messiah, our Lord and Savior Jesus Christ! And some events related to his first coming.

While another Ecliptic Chapter is started by the SIGN of Taurus Including as Taurus' correlated subchapters are the Constellations of Orion (the coming Prince), Eridanus (the river of the judge) and Auriga (the Shepherd).

ORION:

ERIDANUS:

AURIGA:
So, Taurus and its related subchapters (Orion, Eridanus and Auriga) represents our Lord and Savior Jesus Christ in events related to his second coming.

In my preliminary observations On The Book of Genesis I presented the next excerpt from the introduction of the same E. W. Bullinger's book:

"These ancient star-pictures reveal this Coming One. They set forth "the sufferings of Christ and the glory that should follow." Altogether there are forty-eight of them, made up of twelve SIGNS, each sign containing three CONSTELLATIONS."

"… After the Revelation came to be written down in the Scriptures, there was not the same need for the preservation of the Heavenly Volume. And after the nations had lost the original meaning of the pictures, they invented a meaning out of the vain imagination of the thoughts of their hearts. The Greek Mythology is an interpretation of (only some of) the signs and constellations after their true meaning had been forgotten. It is popularly believed that Bible truth is an evolution from, or development of, the ancient religions of the world. But the fact is that they themselves are a corruption and perversion of primitive truth!"

Then, I posted

“An amazing example of an astronomical constellation used as a prophetical tool by its Intelligent Designer can be seen at:”

http://www.cortright.org/revsign.htm
http://www.bytheword.com/birth
http://bibleforums.org/forum/showthread.php?threadid=4157

And that

Elsewhere I have presented an Astronomical simulation of the events that where happening on heaven the year surrounding the birth of Jesus Christ as well as the very same moment of his birth:

http://www.geocities.com/kubyimm1/sm3.htm

Virgo at the day of Jesus' birth and Leo during the year surrounding his birth:
Retrograde motion of Jupiter in Leo's brightest star: Regulus:
The Planetary Retrograde motion explained:
Have a Joyful 2006 Enjoying God’s Word!

Intelligent Design in Culture

2005-12-21T05:04:00.000-08:00

2005, the penetration of Intelligent Design into pop culture.

1. In Sunday's Color-Comics:

Apart from the already mentioned Blog of Dilbert's Designer, we had this early piece from "Opus" [a fragment]:

To see more ...

I posted the dialog of the full version at: "Wall Street Journal on Rick Sternberg, part 2" (05/20/05):

Two boys are talkin' while runnin' on the fields:

> "Pickles, simple chance couldn't have created a dandelion."

- "Nope, hummingbirds neither, Auggie."

> "Or butterflies."

- "Rainbows."

> "There has to be an unseen hand of grace and imagination behind everything."

- "It's called Intelligent Design."

> "Oo, Intelligent Design."

- "Which brings up an existential point... somebody's got some 'splainin' to do."

~ *Snore* (as the two talkin' boys approach the doorstep of their house their old 'daddy' is sleepin' on the couch on his purple housecoat with a cigarette on the left side of his mouth's still, and a beer can at the left side of his head. A drunken thin-garfield cat at his right side is eating a hotdog and a mess of snacks is poured down on the floor, as well as empty drinkin'-cans and hotdog remains).

- About what? ('Opus', the birdish main character asks, while eatin' some 'Chees-Q' snacks and wearing a 'Miami' 'bra-cap' on his head...)

The Lesson: When humans were left to decide by themselves, the original Intelligent Design got messed up!

The President George W. Bush, Senators John McCain and Bill Frist, etc. endorsed the teaching of alternatives to evolution like Intelligent Design.

Keeping Sternberg's case alive, until its final verdict!

2. In TV Series:

Boston Legal
From Whence We Came / Season 1, Episode 12
First broadcast: January 16, 2005, repeat: August 23, 2005 (with Audio fragments in mp3):
Frank Birney .... Judge William Howe
Sam Anderson .... Walter Fife, Defendant
Candice Bergen .... Shirley Schmidt, Defendant's Attorney

Video (end of episode, in Windows Media Player):
Boston Legal - Episode 01x12 From Whence We Came (See there minutes 2:57 to 4:57)

The final speech by the judge in that program was:

"Nobody is more frightened than I am of the religious right getting a stranglehold on our values ("this is the part when we get spanked", declared the defense), it seems, as long as you do it in the name of the Almighty, one is free to abandon not only common sense and science, but also the facts; But I am also concerned about a secular society squeezing faith out of our lives, we all have witnessed the ridiculous lawsuits to stop nativity scenes at Christmas, to take God out of the Pledge of Allegiance. God has always been a part of who and what we are as a Nation. On our currency it reads "In God We Trust", the Declaradion of Independence speaks of God, how we are "created, endowed by Our Creator", being referred as "Our Supreme Judge of the World" and "Divine Providence", GOD! And I'm sorry, anybody who has ever held a new born child in his hands must make room for the chance that a Higher Power exists. It shouldn't offend you, best scientists, to say "Hey, we just don't know". I find the decision to include Intelligent Design along with Evolution into the Science Curriculum does not violate the Establishment Clause of the First Ammendment. I'm ruling in favor of the defendant. This Lawsuit is dismissed."

Several states in the U.S.A. already approved the Critical Analysis of Evolution, like Ohio, Kansas, Minnesota, etc.

3. In Music:
Hip Hop
New Music Canada
“Agency” by FM108
Date Recorded: Feb /2005

In 2004 Glenn Okada presented his "Intelligent Design" album.

http://thedjlist.com/djs/GLENN_OKADA

Intelligent Design appears in several textbooks including the irony presented by Dr. William A. Dembski that "Okay, ID may be taught — But you [Dr. Bill, and any other ID researcher] don’t get to teach it!" (click there to see the full scanned page of the text).

While the Discovery Institute keeps a record of the Media Coverage on TV & Radio Interviews supportive to Intelligent Design in the U.S.A.

So, dear Intelligent Design Student, if you live in Dover, PA, Study ID at home or move to another State in the U.S.A. more open-minded and supportive to the Critical Analysis of Evolution.

That's the beauty of the U.S.A.! The independence of each State to decide, as well as the independence of each Family and Student to decide what and how to teach themselves and their families!

The Decision of Judge John E. Jones III

2005-12-20T21:24:00.000-08:00

Today, Judge John E. Jones III ruled against the teaching of Intelligent Design.

The Maya and Archaeological Decoding

2005-12-20T14:12:00.000-08:00

Tablero del Bulto, Templo XVI
What are those Mayas doing?

[A picture from: “Tablero del Bulto, Grupo XVI. Caliza, 40 x 29 cm. Museo de sitio Alberto Ruz Lhuillier, Palenque Chiapas”]

Some of the other broken links described in comments:

http://www.reocities.com/kubyimm2/image016.jpg

http://www.reocities.com/kubyimm2/ball.jpg

http://www.reocities.com/kubyimm2/ball2.jpg

Decoding Intelligence, Joerg Arnu and Clark

2005-12-20T13:54:00.000-08:00

Along with fellow base-watcher Joerg Arnu, Clark began mapping the sensors, using a handheld frequency counter to sniff out their tell-tale radio transmissions, Arnu said in an interview last year. Together they exhumed as many as 40 of the boxes, noted their unique three-digit codes, then reburied and tested them, said Arnu.

Taken from:
http://www.theregister.co.uk/2005/01/28/area_51_charges_dropped

The precedent events are next:

"The pair found that, at close range, they could use a handheld frequency counter to pick up the wireless signals given off by the devices as a car passes. Over the following month and half, Clark and Arnu engaged in a kind of geocaching game with the Men in Black, systematically sniffing out the road sensors with the frequency counter, exhuming them, and opening them up. They discovered that each device was coded with three-digit identifier that could be read off an internal dial, allowing Arnu to make a list that correlated each unit's I.D. number with its GPS coordinates, creating a virtual map of a portion of the surveillance network surrounding the Groom Lake facility...

Based on their survey, Clark and Arnu have estimated that there are between 75 and 100 sensors...The reaction from the government was immediate, according to Arnu: the road sensors were fitted with a new feature aimed at better eluding detection. Now the transmitters would wait a minute or two before broadcasting an alarm, so that desert wardrivers are out of range before the transmission takes place -- at least, using relatively insensitive detection equipment like a frequency counter...
FBI and Air Force agents raided Clark's trailer home in Rachel, and carted off his computer, photographs and records... they charged Clark with a single count of interfering with a communications system used for the national defense. On March 12th, 2003 Clark allegedly obstructed, hindered and delayed "a signal from a mini intrusion device" located outside "the Nevada Test and Training Range"...

Clark's adventures near the most famously secret patch of real estate in the world appear to have pulled him beneath the very cloak of secrecy he poked and scratched at for so many years. He has, in a sense, become a part of Area 51.

Taken from:
http://www.securityfocus.com/news/8768

DNA Shows Neandertals Were Not Our Ancestors

2005-12-20T13:29:00.000-08:00

Dr. Mark Stoneking, then an associate professor of anthropology at Pennsylvania State University, stated:

"These results [based on mitochondrial DNA extracted from Neanderthal bone] indicate that Neanderthals did not contribute mitochondrial DNA to modern humans… Neanderthals are not our ancestors."²

Illustration of Neanderthal Man. Reprinted from Cell, Vol. 90, 1—3, July 11, 1997.

Subsequent investigation of a second source of Neanderthal DNA confirmed these findings.³

2. DNA Shows Neandertals Were Not Our Ancestors
http://www.psu.edu/ur/NEWS/news/Neandertal.html (broken link)

http://www.mc.maricopa.edu/dept/d10/asb/origins/hominid_journey/neandertal_dna.html

3. Ovchinnikov, et al. "Molecular analysis of Neanderthal DNA from the Northern Caucasus." Nature 404, 490 (2000).

4. “It’s possible that Neanderthals and humans were genetically incompatible, so they could have interbred but their children would have been less fertile,” said Stringer.
This phenomenon is seen in many other species such as when lions breed with tigers and horses breed with zebras.

http://www.timesonline.co.uk/tol/news/science/biology_evolution/article6888874.ece

Some comparisons:

From: http://kodoman.wordpress.com/2007/06/28/neandertaller-insanmis

Chance and necessity do not explain the origin of life

2005-12-20T13:02:00.000-08:00

Trevors JT, Abel DL. Cell Biol Int. 2004;28(11):729-39.

Where and how did the complex genetic instruction set programmed into DNA come into existence? The genetic set may have arisen elsewhere and was transported to the Earth. If not, it arose on the Earth, and became the genetic code in a previous lifeless, physical-chemical world. Even if RNA or DNA were inserted into a lifeless world, they would not contain any genetic instructions unless each nucleotide selection in the sequence was programmed for function. Even then, a predetermined communication system would have had to be in place for any message to be understood at the destination. Transcription and translation would not necessarily have been needed in an RNA world. Ribozymes could have accomplished some of the simpler functions of current protein enzymes. Templating of single RNA strands followed by retemplating back to a sense strand could have occurred. But this process does not explain the derivation of "sense" in any strand. "Sense" means algorithmic function achieved through sequences of certain decision-node switch-settings. These particular primary structures determine secondary and tertiary structures. Each sequence determines minimum-free-energy folding propensities, binding site specificity, and function. Minimal metabolism would be needed for cells to be capable of growth and division. All known metabolism is cybernetic--that is, it is programmatically and algorithmically organized and controlled.